View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20533_low_5 (Length: 208)
Name: NF20533_low_5
Description: NF20533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20533_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 13 - 186
Target Start/End: Original strand, 37149567 - 37149740
Alignment:
| Q |
13 |
agataatactgctaggttaccttatcatcagagccagtgctgccaatgacccgacatcctcgtatcttagcaagttggccagcaatcataccaacagcac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37149567 |
agataatactgctaggttaccttatcatcagagccagtgctgccaatgacccgacatcctcgtatcttagcaagttgaccagcaatcataccaacagcac |
37149666 |
T |
|
| Q |
113 |
cagatgcagcagatatgaacacatttgatcctggctttggatctgctagtacctctattcccaaccatgctgca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
37149667 |
cagatgcagcagatatgaacacatttgatgctggctttgggtttcctagtacctctattcccaaccatgctgca |
37149740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 25 - 186
Target Start/End: Original strand, 37160713 - 37160874
Alignment:
| Q |
25 |
taggttaccttatcatcagagccagtgctgccaatgacccgacatcctcgtatcttagcaagttggccagcaatcataccaacagcaccagatgcagcag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||| || ||||||||| | ||||| ||||||||||||||||||| |
|
|
| T |
37160713 |
taggttaccttatcatcagagccagtgctgccgatgaccctacatcctcggatcttagccagctggccagcatttataccgacagcaccagatgcagcag |
37160812 |
T |
|
| Q |
125 |
atatgaacacatttgatcctggctttggatctgctagtacctctattcccaaccatgctgca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37160813 |
atatgaacacatttgatcctggctttggatctgctagtacctctattcccacccatgctgca |
37160874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 31 - 186
Target Start/End: Original strand, 37153546 - 37153701
Alignment:
| Q |
31 |
accttatcatcagagccagtgctgccaatgacccgacatcctcgtatcttagcaagttggccagcaatcataccaacagcaccagatgcagcagatatga |
130 |
Q |
| |
|
||||||||||| ||||| ||||| || ||||||||||||||||| ||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
37153546 |
accttatcatcggagcccgtgcttccgatgacccgacatcctcggatcttagcaagctggccagcactcatacctacagcaccagatgcagcagatatga |
37153645 |
T |
|
| Q |
131 |
acacatttgatcctggctttggatctgctagtacctctattcccaaccatgctgca |
186 |
Q |
| |
|
| |||| ||||||||| ||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
37153646 |
atacatgtgatcctggttttggatctcctattacctctattcccaaccatgctgca |
37153701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University