View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20535_high_13 (Length: 310)
Name: NF20535_high_13
Description: NF20535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20535_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 14 - 290
Target Start/End: Original strand, 12814145 - 12814421
Alignment:
| Q |
14 |
agaccacaaccttccctccaaatggaattgttttattttttgcgtccacctctttcattatctctctgaaggttctatcaacggcctcaaagcaaaatcg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12814145 |
agaccacaaccttccctccaaatggaattgttttatttttcgcgtccacctccttcattatgtctctgaaggttctatcaacggcctcaaagcaaaatcg |
12814244 |
T |
|
| Q |
114 |
atgcaacattggtgcttcatcccatattataagcttggctttcactatcaatttcccaaggggggaatctagttcaatggtacatgtagaagattcattt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12814245 |
atgcaacattggtgcttcatcccatattataagcttggctttcactatcaatttcccaaggagggaatctggttcaatggtacatgtagaagattcattt |
12814344 |
T |
|
| Q |
214 |
attagtagaggaaagccaaacctcgaatgtgttgtcctcccccctggtattaacaatgcagctatgcctgatgatgt |
290 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12814345 |
attagtagaggaatgcaaaacctcgaatgtgttgtccttccccctggtattaacaatgcagttatgcctgatgatgt |
12814421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 14 - 289
Target Start/End: Complemental strand, 16969093 - 16968824
Alignment:
| Q |
14 |
agaccacaaccttccctccaaatggaattgttttattttttgcgtccacctctttcattatctctctgaaggttctatcaacggcctcaaagcaaaatcg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||| |||| || |||||| |||||||||||||| | |
|
|
| T |
16969093 |
agaccacaaccttccctccaaatggaatttttttatttttcaggtccacctccttcattatgtctcaaaa------atcaacagcctcaaagcaaaacct |
16969000 |
T |
|
| Q |
114 |
atgcaacattggtgcttcatcccatattataagcttggctttcactatcaatttcccaaggggggaatctagttcaatggtacatgtagaagattcattt |
213 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
16968999 |
atgcatcattggtgcttcatcctatattataagcttggctttcactactaatttcccaaggggggaatccggttcaatggtacacgtagaagattcattt |
16968900 |
T |
|
| Q |
214 |
attagtagaggaaagccaaacctcgaatgtgttgtcctcccccctggtattaacaatgcagctatgcctgatgatg |
289 |
Q |
| |
|
||||||| ||||| || |||||||||||| | |||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
16968899 |
attagtacaggaatgcaaaacctcgaatgggctgtccttccacctggtattaacaatgcagctatgcctgatgatg |
16968824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University