View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20536_high_9 (Length: 253)
Name: NF20536_high_9
Description: NF20536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20536_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 234
Target Start/End: Original strand, 40783872 - 40784093
Alignment:
| Q |
13 |
gaagcaaaggatctaaaacatagtcaatgattcccgcatgaccggatcttggcatatgataaagcttaagtttaatcacatgcaagaatttttgtgcaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40783872 |
gaagcaaaggatctaaaacatagtcaatgattcccgcatgaccggatcttggcatatgataaagcttaagtttaatcacatgcaagaatttttgtgcaca |
40783971 |
T |
|
| Q |
113 |
ttcttcttcccaccaaataatttgctttatcagtcactcactgctagcaatgaaatctgtttcattgatctgtgaaatgcacacattagagtatatacct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40783972 |
ttcttcttcccaccaaataatttgctttatcagtcactcactgctagcaatgaaatctgtttcattgatctgtgaaatgcacacattagagtatatacct |
40784071 |
T |
|
| Q |
213 |
tccctaccatggattacaattg |
234 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40784072 |
tccctaccatggattacaattg |
40784093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University