View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20538_high_4 (Length: 250)
Name: NF20538_high_4
Description: NF20538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20538_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 244
Target Start/End: Complemental strand, 45543121 - 45542893
Alignment:
| Q |
15 |
tataggtatttagttcactatcacacttaacgcccatcaaggcatcaacacactactatggtttacttgcaacggtaaaaagtgatgttgttgtaaatca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45543121 |
tataggtatttagttcactatcacacttatcgcccatcaaggcatcaacacactactatggtttacttgcaacggtaaaaagtgatgttgctgtaaatca |
45543022 |
T |
 |
| Q |
115 |
tacgtccatagcacctatgaccccttcattagatctaacgatcatccgaccattatgcctcaagggtaaatccgacatatccatgtaataagggtctatg |
214 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45543021 |
tacgtccatagcacttacga-cccttcattagatctaatgatcatccgaccattacgcctcaagggtaaatccgacatatccatgtaataagggtctatg |
45542923 |
T |
 |
| Q |
215 |
aatagagcgtgccataaaaaacaaggtaca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45542922 |
aatagagcgtgccataaaaaacaaggtaca |
45542893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University