View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20538_low_7 (Length: 236)
Name: NF20538_low_7
Description: NF20538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20538_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 34 - 146
Target Start/End: Original strand, 45542072 - 45542183
Alignment:
| Q |
34 |
agcaaataaaacgtatcttatttagctgcccacataaaacaatgtacaagttttgaagagaggattttatatataatannnnnnnatcacaaaaaaggac |
133 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
45542072 |
agcaactaaaacgtatcttatttagctgcccacaaaaaacaatg-acaagttttgaagagaagattttatatataatattttgttatcacaaaaaaggac |
45542170 |
T |
 |
| Q |
134 |
ataagatgaaata |
146 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45542171 |
ataagatgaaata |
45542183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 167 - 236
Target Start/End: Original strand, 45542713 - 45542782
Alignment:
| Q |
167 |
tacgtgtttgtttttaccactgaacagaaaagtcagtaggaggtaatgtgaagcaaccattgtggcggtt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45542713 |
tacgtgtttgtttttaccactgaacagaaaagtcagtaggaggtaatgtgaagcaaccattgtggcggtt |
45542782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University