View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20538_low_8 (Length: 236)
Name: NF20538_low_8
Description: NF20538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20538_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 2 - 219
Target Start/End: Original strand, 53732842 - 53733057
Alignment:
| Q |
2 |
aaaataagggaatttataacacgcgaacttgttccnnnnnnnnncatgcgaagtttaaaattttggttaatagctctacacactacaataattgtcacaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| || ||||| ||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
53732842 |
aaaataagggaatttataacacgcgaactcgttc--aaaaaaaacacgcgaactttaaaattttggttaatagctctacacactacaataatcgtcataa |
53732939 |
T |
 |
| Q |
102 |
aaatcttactcgaacgaaggagtagtaccctatggatctcgtgagaaaatgttgtactatgtatgtgtaagtgggcgcgcatgcgtgtgtgaaattgtat |
201 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53732940 |
aaatcctactcgaacgaaggagtagtaccctatggatctcgtgagaaaatgttgtactatgtatgtgtaagtggacgcgcatgcgtgtgtgaaattgtat |
53733039 |
T |
 |
| Q |
202 |
gtattaattttgtttttc |
219 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
53733040 |
ggattaattttgtttttc |
53733057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University