View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20538_low_9 (Length: 227)
Name: NF20538_low_9
Description: NF20538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20538_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 7 - 135
Target Start/End: Complemental strand, 1906308 - 1906180
Alignment:
| Q |
7 |
ttccaaacaataatggccatcaaaactatcgattctccaatctctctattaaatggatcttcttactagtatgtttggaaaagaagaaagtggaaggata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
1906308 |
ttccaaacaataatggccatcaaaactatcgattctccaatctctctattaaatggatcttcttactagtttgtttggaaaagaagaaattggaaggata |
1906209 |
T |
 |
| Q |
107 |
gaaattggaggaagagaagtgaagagatt |
135 |
Q |
| |
|
||||| |||||||||||||| |||||||| |
|
|
| T |
1906208 |
gaaatcggaggaagagaagtaaagagatt |
1906180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 184
Target Start/End: Complemental strand, 1905893 - 1905857
Alignment:
| Q |
148 |
aatttaactgctgaatcaatttaattcattttctacg |
184 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| |
|
|
| T |
1905893 |
aatttaaccgttgaatcaatttaattcattttctacg |
1905857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University