View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_high_43 (Length: 332)
Name: NF20539_high_43
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_high_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 13 - 316
Target Start/End: Original strand, 27243767 - 27244071
Alignment:
| Q |
13 |
aatattcaccatacttctatcttttattactagagggaaatggggacctttgctactactcaaaggtaataatagatcaatgtttacaactatcataaga |
112 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27243767 |
aatattcaccatacttctatcctttattactagagggaaatggggacctttgctactactcaaaggtaataatagatcaatgtttacatctatcataaga |
27243866 |
T |
 |
| Q |
113 |
gcactatcactctctcaccaatttacaatgcggtgttaacg-ttaaggatgtagagacaaatgatatttgatcgatcaatcgatcccatcaaattgtttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27243867 |
gcactatcactctctcaccaatttacaatgcggtgttaactattaaggatgtagagacaaatgatatttgatcgatcaatcgatcccatcaaattgtttt |
27243966 |
T |
 |
| Q |
212 |
cttgatgatggttgaaaaatcaatctaaagacttccactgatttgaatcattggttaattcatctgcttagtgtttatgattgttgataatagcttttgt |
311 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27243967 |
cttgatgatggttgaaaaatcagtctaaggacttccactgatttgaatcattggttaattcatctgcttagtgtttatgattgttgataatagcttttgt |
27244066 |
T |
 |
| Q |
312 |
tgatg |
316 |
Q |
| |
|
||||| |
|
|
| T |
27244067 |
tgatg |
27244071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University