View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_high_55 (Length: 272)
Name: NF20539_high_55
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_high_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 18 - 139
Target Start/End: Complemental strand, 39498361 - 39498240
Alignment:
| Q |
18 |
atatgacactaactgaaaaatcagattgaaaaacccatccttgtctatagatgcataacgagttgacaacaaatcacaactaatcatatgtgtaactttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39498361 |
atatgacactaactgaaaaatcagattgaaaaacccatccttgtctatagatgcataacgagttgacaacaaatcacaactaatcatatgtgtaactttg |
39498262 |
T |
|
| Q |
118 |
aaaatatttactttggcggtgt |
139 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39498261 |
aaaatatttactttggcggtgt |
39498240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 175 - 272
Target Start/End: Complemental strand, 39498236 - 39498139
Alignment:
| Q |
175 |
tatgtcatattgatttgaatttgctgataaaaaatttcagacaccccatccactctacaagcctagcaatgattttataccttgcaaagatccactct |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39498236 |
tatgtcatattgatttgaatttgctgataaaaaatttcagacaccccatccactctataagcctagcaatgattttataccttgcaaagatccactct |
39498139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University