View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_high_73 (Length: 242)
Name: NF20539_high_73
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_high_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 39 - 179
Target Start/End: Complemental strand, 6584515 - 6584365
Alignment:
| Q |
39 |
ataaggtaaggggctgtttcgactggatgaacgtct----------aatttcattggtgttgagaatgttcaacgagacattactttaaacatgatgagc |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6584515 |
ataaggtaaggggctgtttcgactggatgaacgtcctctcattcccaatttcattggtgttgagaatgttcaatgagacattactttaaacatgatgagg |
6584416 |
T |
 |
| Q |
129 |
gcaatattatattggggaagaatacaagcttcccccaattttctatttcta |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6584415 |
gcaatattatattggggaagaatacaagcttcccccaattttctatttcta |
6584365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University