View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_high_76 (Length: 241)
Name: NF20539_high_76
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_high_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 225
Target Start/End: Original strand, 3878577 - 3878792
Alignment:
| Q |
10 |
attattctgaatattgctggaaattcattgatttttagtatttatattgatgtagtaaatctccttggaaattgattttatacaggcagggaatttatgg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3878577 |
attattctgaatattgctggaaattcattgattttcagtatttatattgatgtagtaaatctccttggaaattgattttatacaggcagggaatttatgg |
3878676 |
T |
 |
| Q |
110 |
gttcaatgcttgattcttcagatggagtactactgcatgaatggtggtctacgttctatccggtatttgattctagacgaaggaggcatcaagagtctaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3878677 |
gttcaatgcttgattcttcagatggagtactactgcatgaatggtggtctacgttctatccggtatttgattctagacgaaggaggcatcaagagtctaa |
3878776 |
T |
 |
| Q |
210 |
ccgagatccctctaat |
225 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
3878777 |
ccgagagccctctaat |
3878792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University