View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_low_33 (Length: 369)
Name: NF20539_low_33
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 20871 - 21093
Alignment:
| Q |
18 |
gttgggtgaaagtgagagcttcatcatcaattcccaaatcagtggccatagtacgaagcagagaagtaaggtgagagacgtctggagaaagaggaggagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20871 |
gttgggtgaaagtgagagcttcatcatcaattcccaaatcagtggccatagtacgaagcagagaagtaaggtgagagacgtctgaagaaagaggaggagt |
20970 |
T |
 |
| Q |
118 |
gaaggggtgtttgtcgtagtaagacgacaggaaggccctagttatgggcaccaaaccctctgtagaagcagcc------atcggaatcggaggattggat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20971 |
gaaggggtgtttgtcgtagtaagacgacaggaaggccctagttatgggcaccaaaccctctgtagaagcagccatcggaatcggaatcggaggattggat |
21070 |
T |
 |
| Q |
212 |
tatcagacagatctaaatcccac |
234 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
21071 |
tatcagacagatctaaatcccac |
21093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 299 - 359
Target Start/End: Original strand, 21153 - 21214
Alignment:
| Q |
299 |
ctactcaaccccattcattgatccctctcgaatattcgcttcc-tttttattttattctctg |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
21153 |
ctactcaaccccattcattgatccctctcgaatattctcttcctttttttttttattctctg |
21214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University