View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_low_35 (Length: 360)
Name: NF20539_low_35
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_low_35 |
 |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 21691 - 21382
Alignment:
| Q |
1 |
ttgtaatgagcatgagtccaaaaaatagagaccatcacaaccgtcttctatgtacttttttctttggcatcgttattgtaagttgtagcagtattgaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21691 |
ttgtaatgagcatgagtccaaaaaatagagaccatcacaaccgtcttctatgtacttttttctttggcatcgttattgtaagttgtaacagtattgaata |
21592 |
T |
 |
| Q |
101 |
attgaaccaaaaggtttttgaagataacttgatatagcacgtggacattatacatacaatattttggatcaattaatatcaatatagga---tattagtt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21591 |
attgaaccaaaaggtttttgaagataacttgatatagcacgtggacattatacatacaatattttggatcaattaatatcaatataggattgtattagtt |
21492 |
T |
 |
| Q |
198 |
ttatatgaattttattgatctgactattctattttaggtgnnnnnnnaagggaaatactaacaagtattttaaagacacttataaaaagtctaacggaaa |
297 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||||||| |||| ||||| |
|
|
| T |
21491 |
ttatatgatttttattgatctgactattctattttaggtg-ttttttaagggaaatactgacaagtattctaaagacacttataaaaagactaaaggaaa |
21393 |
T |
 |
| Q |
298 |
tgttaacgagt |
308 |
Q |
| |
|
||||||||||| |
|
|
| T |
21392 |
tgttaacgagt |
21382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University