View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_low_59 (Length: 264)
Name: NF20539_low_59
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_low_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 258
Target Start/End: Original strand, 25301025 - 25301272
Alignment:
| Q |
11 |
aatgaatcttccaccatcttagaatcgtgttacaaagtccaagtcttcacaacataaataatttgaacaacactttatgtattagtaacttgtttgagtt |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25301025 |
aatgaattttccaccatcttagaatcgtgttacaaagtccaagtcttcacaacataaataatttgaacaacactttatgtattagtaacttgtttgggtt |
25301124 |
T |
 |
| Q |
111 |
tcatgcgaaaatttccttctcaataaattataccaaaacaatatcctctcactattatgatcacttgaaagttgaatccaaaatatacaagcagttggta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25301125 |
tcatgcgaaaatttccttctcaataaattataccaaaaaaatatcctctcactattatgatcacttgaaagttgaatccaaaatatacaagcagttggta |
25301224 |
T |
 |
| Q |
211 |
tagatttagtgcatttacagtgttaaaaaatttgcatcttaacattcc |
258 |
Q |
| |
|
|| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25301225 |
taaatttagtgcatttacaatgttaaaaaatttgcatcttaacattcc |
25301272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University