View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_low_64 (Length: 250)
Name: NF20539_low_64
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_low_64 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 40790955 - 40790715
Alignment:
| Q |
9 |
gaagaatattggtggggaacaaatcattnnnnnnnngtaagataattaaggatcttttacaatatgcctttgcatattatatggacccttctcccacgta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40790955 |
gaagaatattggtggggaacaaatcattaaaaaaaagtaagataattaaggatcttttacaatatgcctttgcatattatatggacccttctcccacgta |
40790856 |
T |
|
| Q |
109 |
tggccacatctacatatatatgaagnnnnnnnnncatgaatggaatttttagcactgaagtgagaaagaatctttagtattttgatcgatgaccccatct |
208 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40790855 |
tggccacaactacatatatatgaagaaaaaaaa-catgaatggaatttttagcactgaagtaagaaagaatctttagtattttgattgatgaccccatct |
40790757 |
T |
|
| Q |
209 |
atcgatcatgattgattgagatcattatatggtcttcacaaa |
250 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40790756 |
atctatcatgattgattgagatcattatatggtcttcacaaa |
40790715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University