View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_low_65 (Length: 250)
Name: NF20539_low_65
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_low_65 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 52507304 - 52507070
Alignment:
| Q |
16 |
attcgatgaatgtaaacaatgttttcattgcaacgtaaaaatagatttcattaattgtgatgtaaaaatagatataatattgatttgctttctgaaacca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
52507304 |
attcgatgaatgtaaacaatgttttcattgcaacgtaaaaatagatttcattaattgtgatgtaaaaataaatataatattgatttgctttctggaacca |
52507205 |
T |
|
| Q |
116 |
taatttgtatctttcaaccaactaagcgatataccctaatcattcaagttaaccctccttgtaaatagcttcggtccatatttgttagtagtatttccac |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52507204 |
taatttgtatctttcaaccgactaagcgatataccctaatcattcaagttaaccctccttgtaaatagcttcggtccatatttgttagtagtatttccac |
52507105 |
T |
|
| Q |
216 |
tttgtatctacttctcttcgttttttctcataatt |
250 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| |
|
|
| T |
52507104 |
tttgtatctacttttcttcgatttttctcataatt |
52507070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University