View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_low_72 (Length: 245)
Name: NF20539_low_72
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_low_72 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 13 - 245
Target Start/End: Complemental strand, 45696045 - 45695813
Alignment:
| Q |
13 |
aaaatattgattttatctacttttgtcgtcaattactagtgttattaaatagggaccggtttgtcacatagtgacagtactatagtagtggggcttgttt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45696045 |
aaaatattgattttatctacttttgtcgtcaattattagtgttattaaatagggaccggtttgtcacatagtgacagtactatagtagtggggcttgttt |
45695946 |
T |
|
| Q |
113 |
caggtttctgtgtctacaacctttgtttgtattgttcgcggtcaatgtagcgtatttatgttggtggcgtaagtttctgtgttttataactttgtttttc |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45695945 |
caggtttctgtgtctacaaactttgtttgtattgttcgcggtcaatgtagcgtatttatgttggtagcgtaagtttctgtgttttataactttgtttttc |
45695846 |
T |
|
| Q |
213 |
attattgtttatgatgcccctgcatgagttata |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45695845 |
attattgtttatgatgcccctgcatgagttata |
45695813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University