View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_low_91 (Length: 227)
Name: NF20539_low_91
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_low_91 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 45695466 - 45695686
Alignment:
| Q |
7 |
tgtatttgtttcattagcatattgtcctgaatatttatcatgccccttaagagtatgagatggtaaagttggagtcattttagctctattggaattacta |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45695466 |
tgtatttgtttcattagcatgttgtcctgaatatttatcatgccccttaagagtatgagatggtaaagttggagtcattttagctctattggaattacta |
45695565 |
T |
|
| Q |
107 |
gattgaccatgcactaaaatctggtcattttgccaaaccagctcaaacaaatcgtttctcggtctgcattgaatcacacaaggacagtgttaatagaaat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45695566 |
gattgaccatgcactaaaatctggtcattttgccaaaccagctcaaacaaatcgtttctgggtctgcattgaatcacacaaggacagtgttaatagaaat |
45695665 |
T |
|
| Q |
207 |
taaacaaaataaataaaccaa |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45695666 |
taaacaaaataaataaaccaa |
45695686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University