View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20539_low_94 (Length: 210)
Name: NF20539_low_94
Description: NF20539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20539_low_94 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 2 - 195
Target Start/End: Complemental strand, 52507090 - 52506897
Alignment:
| Q |
2 |
tcttcgttttttctcataattaagggtgtatatatataaaatttagttttatttacttcacaaaccaaacttattctttatcccggataagcaggttcta |
101 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
52507090 |
tcttcgatttttctcataattaagggtgtatatatataaaatttagttttatttacttcacaaaccgaacttattcttcatccccgataagcaggttcta |
52506991 |
T |
|
| Q |
102 |
gttttctcgtttgtagccaatttttaatccgaaatcttgttgccaatttttaatccgaaatcacacaattctacatcttttttctccatatttt |
195 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52506990 |
gttttctcgtttatagtcaatttttaatccgaaatcttgttgccaatttttaatccgaaatcacacaattctacatcttttttcttcatatttt |
52506897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University