View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2053_high_7 (Length: 228)

Name: NF2053_high_7
Description: NF2053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2053_high_7
NF2053_high_7
[»] chr8 (1 HSPs)
chr8 (15-218)||(41113955-41114158)


Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 41114158 - 41113955
Alignment:
15 gaaatgaaattgagtgaaaccatcggttcagttttacaataaaaaatgaaggtagaaaacgtttataaaatattttgggaaaaattagttcgtgacattg 114  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||    
41114158 gaaatgaaattgagtgaaaccatcggatcagttttacaataaaaaatgaaggtagaaaacgtttataaaatattttggtaaaaattagttcgtgacagtg 41114059  T
115 tgtattgtcagttagatggtccttatgttggattggattttttctaatgcagactgcctcacacatggtgtcaaacttctcaagttggagacgttatgat 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
41114058 tgtattgtcagttagatggtccttatgttggattggattttttctaatgcagactgcctcacacatggtgtcaaacttctcaagatggagacgttatgat 41113959  T
215 gata 218  Q
    ||||    
41113958 gata 41113955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University