View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20541_low_6 (Length: 345)
Name: NF20541_low_6
Description: NF20541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20541_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 3e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 240 - 329
Target Start/End: Complemental strand, 889139 - 889050
Alignment:
| Q |
240 |
tataatttatgtcatgtgcagttccatcaattatggaactgaactaccattagctaatttgaagattaccatatgcaacaacaaactcac |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
889139 |
tataatttatgtcatgtgcagttccatcaattatggaagtgaactaccattagctaacttgaagattcccatatgcaacaacaaactcac |
889050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 23 - 158
Target Start/End: Original strand, 29221999 - 29222137
Alignment:
| Q |
23 |
tcactcacatacataaatgaaaggtcggatttcgaaccacaatcacattactcactataacaattttagtattttttacctc----nnnnnnnnntagta |
118 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| ||| |||||||||||| | ||||| |||||||||||||| |||| ||||| |
|
|
| T |
29221999 |
tcactcacatgcataaatggaaggtcggatttcgaatcacggtcacattactcagtgtaacagttttagtatttttt-cctcaaaaagaaaaaaatagta |
29222097 |
T |
 |
| Q |
119 |
ttttgtcggttgacctaggagttgtggaccttcaaattgt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29222098 |
ttttgtcggttgacctaggagttgtggaccttcaaattgt |
29222137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 223 - 294
Target Start/End: Original strand, 18466605 - 18466676
Alignment:
| Q |
223 |
catgtttttaatgacattataatttatgtcatgtgcagttccatcaattatggaactgaactaccattagct |
294 |
Q |
| |
|
|||||| ||||||||||| ||||| |||| |||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
18466605 |
catgttcttaatgacattttaattgttgtcttgtgcagtaccatcaattatggaagtgaactaccattagct |
18466676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 114 - 158
Target Start/End: Complemental strand, 37035916 - 37035872
Alignment:
| Q |
114 |
tagtattttgtcggttgacctaggagttgtggaccttcaaattgt |
158 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37035916 |
tagtattttgtcggttgacctaggacttgtggaccttcaaattgt |
37035872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University