View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20542_high_2 (Length: 221)
Name: NF20542_high_2
Description: NF20542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20542_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 87 - 214
Target Start/End: Complemental strand, 15683359 - 15683232
Alignment:
| Q |
87 |
atcttcatcacacaaatttcggtctagactcaacatactcaaattctaaattttcatccttttcttgcattcaaaccataccccacacaaacttccaact |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15683359 |
atcttcatcacacaaatttcggtctagactcaacatactcaaactctaaattttcatccttttcttgcattcaagccataccccacacaaacttccaact |
15683260 |
T |
 |
| Q |
187 |
tttcacactcacagtcatcttcatttca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
15683259 |
tttcacactcacagtcatcttcatttca |
15683232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University