View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20542_high_3 (Length: 218)
Name: NF20542_high_3
Description: NF20542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20542_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 36273575 - 36273768
Alignment:
| Q |
17 |
atcaatgtcatgtcatattctacnnnnnnntaaacccaataacttcatgaccgaaatgaggtctaacnnnnnnnnnnnnngttgaactttttaaagaagg |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36273575 |
atcaatgtcatgtcatattctacaaaaaa-taaacccaatagcttcatgaccgaaatgaggtctaacaaaaaatgaaaaagttgaactttttaaagaagg |
36273673 |
T |
|
| Q |
117 |
gg-accaaatcaatatgtgggacatgaactttatcaacaatgcaaggtgaagcgaggtagaaaatgttattgcaacatcggagaatggtgatgat |
210 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36273674 |
gggaccaaatcaatatgtgggacatgaactttatcaacaatgcaaggtgaagcgaggtagaaaatgttattgcaacatcggagaatggtgatgat |
36273768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University