View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20542_high_4 (Length: 213)
Name: NF20542_high_4
Description: NF20542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20542_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 38 - 105
Target Start/End: Original strand, 42289889 - 42289956
Alignment:
| Q |
38 |
acatcatcaaattatctatatagtgatgatataatcaatcaagttttaccctttttataccgcaatag |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42289889 |
acatcatcaaattatctatataatgatgatataatcaatcaagttttaccctttttataccgcaatag |
42289956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 42289994 - 42290047
Alignment:
| Q |
142 |
gacatttacttgccagtataaactagtttcacattcattttagatgtcaagtat |
195 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42289994 |
gacatttacttgccaggataaactagtttcacattcactttagatgtcaagtat |
42290047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University