View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20544_high_1 (Length: 233)
Name: NF20544_high_1
Description: NF20544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20544_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 34428059 - 34427857
Alignment:
| Q |
16 |
caaaggtccacaatcaagttcgagagaagtatgtcaaccaatcccttatctttgccagtgagaaaaattgaatacccttctatttaatctccaaaagcaa |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34428059 |
caaagttccacaatcaagttcgagagaagtatgtcaaccaatcccttatctctgcctgtgagaaaaattgaatacccttctatttaatctccaaaagcaa |
34427960 |
T |
 |
| Q |
116 |
tttttaaaagcttaattgcttacaaaagaaatggaaaaatcaaatagagtaagagactatatatattataaaaacatatacatcaaaattatgacaagaa |
215 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34427959 |
tttttaaaagcttaattgcttacacaagaaatggaaaaatctaatagagtaagagactatatatactataaaaacatatacatcaaaattatgacaagaa |
34427860 |
T |
 |
| Q |
216 |
tgt |
218 |
Q |
| |
|
||| |
|
|
| T |
34427859 |
tgt |
34427857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University