View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20545_high_7 (Length: 279)
Name: NF20545_high_7
Description: NF20545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20545_high_7 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 20 - 279
Target Start/End: Complemental strand, 40383447 - 40383188
Alignment:
| Q |
20 |
aacggtaactcaattgcgtcctcagttgccacttttgcaaatccgttttggattgaaatggcagttattggaaaacggtctctactaaactcaagacgga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383447 |
aacggtaactcaattgcgtcctcagttgccacttttgcaaatccgttttggattgaaatggcggttattggaaaacggtctctactaaactcaagacgga |
40383348 |
T |
|
| Q |
120 |
tgccggaattattcggaatccgtctcggtgcagttctggttaccggaggaatcttggccaccatcttttaccgtcttgacgattcaccaaaaggtgttca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383347 |
tgccggaattattcggaatccgtctcggtgcagttctggttaccggaggaatcttggccaccatcttttaccgtcttgacgattcaccaaaaggtgttca |
40383248 |
T |
|
| Q |
220 |
agagcgtttgggtttcttcgcctttgccatgtcaacaaccttctacacttgtgctgaagc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383247 |
agagcgtttgggtttcttcgcctttgccatgtcaacaaccttctacacttgtgctgaagc |
40383188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University