View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20547_high_8 (Length: 235)
Name: NF20547_high_8
Description: NF20547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20547_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 39590231 - 39590441
Alignment:
| Q |
13 |
atcataggtgatatccagtatccccatatccaccctttttctatatcatctgaaaccataaagccaaagaaatagacatatattgttactccaaatctag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39590231 |
atcataggtgatatccagtatccccatatccaccctttttctatatcatctgaaaccataaagccaaagaaatagacatatattgttactccaaatctag |
39590330 |
T |
 |
| Q |
113 |
aaaaataatacaaacaataaacataaatattgaattttctatccatgatctataataccttttgagagggaaaaaccactcatgacaaccagcaaagcca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39590331 |
aaaaataatacaaacaataaacataaatattgaattttctatccatgatctataataccttttgagagggaaaaaccactcatgacaaccagcaaagcca |
39590430 |
T |
 |
| Q |
213 |
atgtaaatgat |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
39590431 |
atgtaaatgat |
39590441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 57
Target Start/End: Original strand, 39565710 - 39565754
Alignment:
| Q |
13 |
atcataggtgatatccagtatccccatatccaccctttttctata |
57 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||| |||| |
|
|
| T |
39565710 |
atcataggtgatatccagaatccccatatccacccattttttata |
39565754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 39575997 - 39576055
Alignment:
| Q |
18 |
aggtgatatccagtatccccatatccaccctttttctatatcatctgaaaccataaagc |
76 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
39575997 |
aggtgatatccagaagccccatatccacccttttgtaatattatctgaaaccaaaaagc |
39576055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University