View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20548_high_16 (Length: 301)

Name: NF20548_high_16
Description: NF20548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20548_high_16
NF20548_high_16
[»] chr7 (2 HSPs)
chr7 (16-283)||(49041005-49041272)
chr7 (109-193)||(49040232-49040316)
[»] chr1 (2 HSPs)
chr1 (123-284)||(15239531-15239692)
chr1 (110-283)||(34053231-34053404)


Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 16 - 283
Target Start/End: Original strand, 49041005 - 49041272
Alignment:
16 cagagacagggacactaacgggatacttatgaacagagtcatcccaggggttgccccgccaatccccaacgacgggcaagtcgcgcacggccttccacac 115  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
49041005 cagaaacagggacactaacgggatacttatgaacagagtcatcccaggggttgccccgccaatccccaacgacgggcaagtcacgcacggccttccacac 49041104  T
116 ggcgctgttacacttaaaacccgacccaaatgcaatctgccagacccgatccccttttgcaaccctgccctttgcctcagtataagccagttcataccat 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
49041105 ggcgctgttacacttaaaacccgacccaaatgcaatctgccagacccgatccccttttgcaacccggccctttgcctcagtataagccagttcataccat 49041204  T
216 agagaactgcttgaagtgtttccaaatctatgcagagtcatccgagacggttccatatgccactcact 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49041205 agagaactgcttgaagtgtttccaaatctatgcagagtcatccgagacggttccatatgccactcact 49041272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 109 - 193
Target Start/End: Complemental strand, 49040316 - 49040232
Alignment:
109 tccacacggcgctgttacacttaaaacccgacccaaatgcaatctgccagacccgatccccttttgcaaccctgccctttgcctc 193  Q
    |||| ||||| |||||||| |||||||| | |||||||||||||||||| |||| |||||| |||| ||| || ||||| |||||    
49040316 tccatacggcactgttacatttaaaacctgccccaaatgcaatctgccacaccctatccccctttgaaactctacccttggcctc 49040232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 123 - 284
Target Start/End: Complemental strand, 15239692 - 15239531
Alignment:
123 ttacacttaaaacccgacccaaatgcaatctgccagacccgatccccttttgcaaccctgccctttgcctcagtataagccagttcataccatagagaac 222  Q
    |||||||||||||| || ||||||||||| |||||    | ||| ||||||  || ||| || || || ||||||||||||| ||||||||| |  ||||    
15239692 ttacacttaaaaccagaaccaaatgcaatttgccaagttctatcaccttttttaatcctccctttagcttcagtataagccaattcataccacaatgaac 15239593  T
223 tgcttgaagtgtttccaaatctatgcagagtcatccgagacggttccatatgccactcactt 284  Q
    | || |||||||| |||||||||| ||| |||||||  || |||||||||||||| ||||||    
15239592 tactagaagtgttaccaaatctattcagtgtcatccttgatggttccatatgccaatcactt 15239531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 110 - 283
Target Start/End: Complemental strand, 34053404 - 34053231
Alignment:
110 ccacacggcgctgttacacttaaaacccgacccaaatgcaatctgccagacccgatccccttttgcaaccctgccctttgcctcagtataagccagttca 209  Q
    |||||| || |||||||| ||||| || || ||||||||||| |||||   || ||| ||||||  || ||| || || || ||||||||||||| ||||    
34053404 ccacacagcactgttacatttaaatccagaaccaaatgcaatttgccaagtcctatcaccttttctaatcctccctttagcttcagtataagccaattca 34053305  T
210 taccatagagaactgcttgaagtgtttccaaatctatgcagagtcatccgagacggttccatatgccactcact 283  Q
    |||||||  ||||| || ||||| || ||||||||||  || ||||| |  || |||||||||||||| |||||    
34053304 taccataatgaactactagaagtattaccaaatctatttagtgtcattcttgatggttccatatgccaatcact 34053231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University