View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20548_high_23 (Length: 233)
Name: NF20548_high_23
Description: NF20548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20548_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 445212 - 445433
Alignment:
| Q |
1 |
cagggccatagattgagtgagtggccaatgatatcttgattatcaatgttttgaacagcttgagtgaatcttttgttttagtttagctgcttagtagaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
445212 |
cagggccatagattgagtgagtggccaatgatatcttgattatcaatgttttgaacagcttgagtgaatcttttgttttagtttagctgcttagtagaat |
445311 |
T |
|
| Q |
101 |
ttggcattaactagtctttggttcagggtgcttagttggtacatgcatgcacctatccatttgttttcgtcccatgtataatctctattcgctatagtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
445312 |
ttggcattaactagtctttggttcagggtgcttagttggtacatgcatgcacctatccatttgttttcgtcccatgtataatctctattcgctatagtat |
445411 |
T |
|
| Q |
201 |
ttctcgctggcttaagcatttt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
445412 |
ttctcgctggcttaagcatttt |
445433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 17138966 - 17138905
Alignment:
| Q |
1 |
cagggccatagattgagtgagtggccaatgatatcttgattatcaatgttttgaacagcttg |
62 |
Q |
| |
|
|||||||| ||||||||| |||| | ||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
17138966 |
cagggccacagattgagtcagtgactaatgataatttgattatcaatgttttcaacagcttg |
17138905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University