View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20548_low_21 (Length: 238)
Name: NF20548_low_21
Description: NF20548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20548_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 48041666 - 48041799
Alignment:
| Q |
1 |
tttaaaatgaacttttactgaagtacctgttaataaaaataatataaatacataatagatgcatgatgaattatagatttgtatttctttatttatctac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48041666 |
tttaaaatgaacttttactgaagtacctgttaataaaaataatataaatacataatagatgcatgatgaattatagatttgaatttctttatttatctac |
48041765 |
T |
 |
| Q |
101 |
tgtttaaagagtccaaattaatataaattcaatg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
48041766 |
tgtttaaagagtccaaattaatataaattcaatg |
48041799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University