View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20548_low_21 (Length: 238)

Name: NF20548_low_21
Description: NF20548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20548_low_21
NF20548_low_21
[»] chr4 (1 HSPs)
chr4 (1-134)||(48041666-48041799)


Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 48041666 - 48041799
Alignment:
1 tttaaaatgaacttttactgaagtacctgttaataaaaataatataaatacataatagatgcatgatgaattatagatttgtatttctttatttatctac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
48041666 tttaaaatgaacttttactgaagtacctgttaataaaaataatataaatacataatagatgcatgatgaattatagatttgaatttctttatttatctac 48041765  T
101 tgtttaaagagtccaaattaatataaattcaatg 134  Q
    ||||||||||||||||||||||||||||||||||    
48041766 tgtttaaagagtccaaattaatataaattcaatg 48041799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University