View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20548_low_23 (Length: 234)
Name: NF20548_low_23
Description: NF20548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20548_low_23 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 2 - 234
Target Start/End: Original strand, 39299917 - 39300149
Alignment:
| Q |
2 |
tcttcctcttccaccaatatctcccaaaccttcacctctttctttcatgccttctgcaccttgtctgtgtccaactacatttgtagcatgatgacgatcc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299917 |
tcttcctcttccaccaatatctcccaaaccttcacctctttctttcatgccttctgcaccttgtctgtgtccaactacatttgtagcatgatgacgatcc |
39300016 |
T |
 |
| Q |
102 |
ctctcactctgtttcacattttgatcagagtgagactgaaaaccttgtttgtgtccaaggttggtagcagcagcatgatgatgatccctatcactctgct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300017 |
ctctcactctgtttcacattttgatcagagtgagactgaaaaccttgcttgtgaccaaggttcgtagcagcagcatgatgatgatccctatcactctgct |
39300116 |
T |
 |
| Q |
202 |
tcacatttgaaccaagttcatgagtctctcttg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39300117 |
tcacatttgaaccaagttcatgagtctctcttg |
39300149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University