View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20548_low_26 (Length: 223)
Name: NF20548_low_26
Description: NF20548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20548_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 29 - 206
Target Start/End: Complemental strand, 28674689 - 28674511
Alignment:
| Q |
29 |
tgtgttgatttattttcttgttttgacatcttgagttgtacgagagaatcttttatggttctatggtaata-aatatagaaaaacatggaaacatgatct |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28674689 |
tgtgttgatttattttcttgttttgacatcttgagttgtacgagagaatcttttatggttctatggtaatataatatagaaaaacatggaaacatgatct |
28674590 |
T |
 |
| Q |
128 |
gagttctcgaggatattgatgccttggttgatataaacaagtttgaagctagagtgtagggtttttctgtgcaagtgat |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28674589 |
gagttctcgaggatattaatgccttggttgatataaacaagtttgaagctagagtgtagggtttttctgtgcaagtgat |
28674511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University