View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2054_high_4 (Length: 354)
Name: NF2054_high_4
Description: NF2054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2054_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 16 - 343
Target Start/End: Original strand, 38791591 - 38791919
Alignment:
| Q |
16 |
attagagggattgagaaaacaaaatggctaacgacctaaaagctgagttagggtttgtcgacagtggcgttgcaggtcctgatattccgttcaccgatga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38791591 |
attagagggattgagaaaacaaaatggctaacggccgaaaagctgagttagggtttgtcgacagtggcgttgcaggtcctgatattccgttcaccgatga |
38791690 |
T |
 |
| Q |
116 |
agatatgtctcactggtcaaacccatggaaacacacgctcattgttcaaatccttgctgaacaaaatctcacctttcaaacactacaacacaagcttcac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38791691 |
agatatgtctcactggtcaaacccatggaaacacacgctcattgttcaaatccttgctgaacaaaatctcacctttcaaacactacaacacaagcttcac |
38791790 |
T |
 |
| Q |
216 |
cattcttgga-caaaaatggtggaaccattacagtaacagatatggaaaatgggttcttctctgtgaagttcgcaactgaagaagattacaatcatgccc |
314 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38791791 |
cattcttggaccaaaaatggtggaaccattacagtaacagatatggaaaatgggttcttctctgtgaagttcgcaactgaagaagattacaatcatgccc |
38791890 |
T |
 |
| Q |
315 |
tttacaacggaccttggatggtggctgat |
343 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38791891 |
tttacaacggaccttggatggtggctgat |
38791919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University