View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2054_low_6 (Length: 268)
Name: NF2054_low_6
Description: NF2054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2054_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 94 - 249
Target Start/End: Original strand, 43839598 - 43839753
Alignment:
| Q |
94 |
ccaacatccaaaggaaccttgaactgtgcaatctcttccggatttttaacaaactgattcaaccggcggcgaagagtggacaaaagtggctgggattgaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43839598 |
ccaacatccaaaggaaccttgaactgtgcaatctcttccggatttttaacaaactgattcaaccggcggcgaagagtggacaaaagtggctgggattgaa |
43839697 |
T |
|
| Q |
194 |
gatcaatttgatgccaaatctgctcagcatcgtaaccatcaacgagaagctcatcc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43839698 |
gatcaatttgatgccaaatctgctcagcatcgtaaccatcaacgagaagctcatcc |
43839753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University