View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20550_high_12 (Length: 243)
Name: NF20550_high_12
Description: NF20550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20550_high_12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 111 - 243
Target Start/End: Original strand, 19371016 - 19371148
Alignment:
| Q |
111 |
cctgctaccacggggcataaatagtgtactgcttttgcttcacttaaatgataaatctcaatctatcattctagtgtttgcttccgtaatgcctaccaga |
210 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
19371016 |
cctgctaccttggggcataaatagtgtacagcttttgcttcacttaaatgataaatctcaatctatcattctagtgtttgcttccataatgcctagcaga |
19371115 |
T |
|
| Q |
211 |
gaatgcttcgttcttttattgagttcatttttc |
243 |
Q |
| |
|
|||||||| |||| |||||||| |||||||||| |
|
|
| T |
19371116 |
gaatgctttgttcatttattgaattcatttttc |
19371148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University