View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20550_high_6 (Length: 284)
Name: NF20550_high_6
Description: NF20550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20550_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 36938693 - 36938967
Alignment:
| Q |
1 |
aactctagtttagattttgaagcacacaaagacgaaggaaaaacaggacttgttatgggactagcagtgggattaggaattggtggatttgttttgattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36938693 |
aactctagtttagattttgaagcacacaaagacgaaggaaaaacaggacttgttatgggactagcagtgggattaggaattggtggatttgttttgattg |
36938792 |
T |
|
| Q |
101 |
gtgtattgggtcttttttccattgtgttgtggaagaagtggaagaaagaaagtgaagaggaagatggtgaatttgaagagtacatgggagaggattttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36938793 |
gtgtattgggtcttttttccattgtgttgtggaagaagtggaagaaagaaagtgaagaggaagatggtgaatttgaagagtacatgggagaggattttgg |
36938892 |
T |
|
| Q |
201 |
aaggggggcaggacctaggaagtattcatatgcagaattagcacacgcagctaatgatttcaaagacgagtataa |
275 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36938893 |
aaggggggcaggacctaggaagtatacatatgcagaattagcacacgcagctaatgatttcaaagacgagtataa |
36938967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 158 - 275
Target Start/End: Complemental strand, 36942268 - 36942151
Alignment:
| Q |
158 |
aggaagatggtgaatttgaagagtacatgggagaggattttggaaggggggcaggacctaggaagtattcatatgcagaattagcacacgcagctaatga |
257 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || ||||| ||||| ||| ||||||| | ||||||| ||||||||||||||||| | ||||||||| | |
|
|
| T |
36942268 |
aggaagatggtgaatttcaagagtacatgggtgaagatttcggaagagggacaggacccaagaagtatacatatgcagaattagcaaatgcagctaataa |
36942169 |
T |
|
| Q |
258 |
tttcaaagacgagtataa |
275 |
Q |
| |
|
||||||||| ||| |||| |
|
|
| T |
36942168 |
tttcaaagatgagcataa |
36942151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 111
Target Start/End: Complemental strand, 36942359 - 36942306
Alignment:
| Q |
58 |
ggactagcagtgggattaggaattggtggatttgttttgattggtgtattgggt |
111 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||| | ||||||||||| ||| |
|
|
| T |
36942359 |
ggactagcagtgggattgggaaccggtggatttgttctcattggtgtatttggt |
36942306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University