View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20550_low_12 (Length: 243)

Name: NF20550_low_12
Description: NF20550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20550_low_12
NF20550_low_12
[»] chr5 (1 HSPs)
chr5 (111-243)||(19371016-19371148)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 111 - 243
Target Start/End: Original strand, 19371016 - 19371148
Alignment:
111 cctgctaccacggggcataaatagtgtactgcttttgcttcacttaaatgataaatctcaatctatcattctagtgtttgcttccgtaatgcctaccaga 210  Q
    |||||||||  |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||    
19371016 cctgctaccttggggcataaatagtgtacagcttttgcttcacttaaatgataaatctcaatctatcattctagtgtttgcttccataatgcctagcaga 19371115  T
211 gaatgcttcgttcttttattgagttcatttttc 243  Q
    |||||||| |||| |||||||| ||||||||||    
19371116 gaatgctttgttcatttattgaattcatttttc 19371148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University