View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20551_high_12 (Length: 336)
Name: NF20551_high_12
Description: NF20551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20551_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 29 - 206
Target Start/End: Complemental strand, 42933434 - 42933257
Alignment:
| Q |
29 |
aactcatagtatgatctctaagatgaggtggaacattcttgatcatgttggtgattttaccaacaccaaacaatttatgagcgtttaagaattgtttttg |
128 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933434 |
aactcatggtatgatctctaagatgaggtggaacattcttgatcatattggtgattttaccaacaccaaacaatttatgagcgtttaagaattgtttttg |
42933335 |
T |
|
| Q |
129 |
acgatcgtgaggaaaatatggtgcgagaatgcaggatgtaccacacttcctacgttgatatttacatgcagcacaagc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933334 |
acgatcgtgaggaaaatatggtgcgagaatgcaggatgtaccacacttcctacgttgatatttacatgcagcacaagc |
42933257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 264 - 327
Target Start/End: Complemental strand, 42933205 - 42933142
Alignment:
| Q |
264 |
catgcttcatggaaaaaccaaaccctaaattttataataagctaagcgtctccgctgcctatgc |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933205 |
catgcttcatggaaaaaccaaaccctaaattttataataagctaagcgtctccgctgcctatgc |
42933142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University