View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20551_high_20 (Length: 307)
Name: NF20551_high_20
Description: NF20551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20551_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 30 - 292
Target Start/End: Complemental strand, 49041272 - 49041010
Alignment:
| Q |
30 |
agtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatggtatgaactggcttatactgaggcaaagg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49041272 |
agtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatggtatgaactggcttatactgaggcaaagg |
49041173 |
T |
|
| Q |
130 |
gcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtgtggaaggccgtgcgcgacttgcccgtcgt |
229 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49041172 |
gccgggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtgtggaaggccgtgcgtgacttgcccgtcgt |
49041073 |
T |
|
| Q |
230 |
tggggattggcggggcaacccctgggatgactctgttcataagtatcccgttagtgtccctgt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49041072 |
tggggattggcggggcaacccctgggatgactctgttcataagtatcccgttagtgtccctgt |
49041010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 120 - 204
Target Start/End: Original strand, 49040232 - 49040316
Alignment:
| Q |
120 |
gaggcaaagggcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtgtgga |
204 |
Q |
| |
|
||||| ||||| || ||| |||| |||||| |||| |||||||||||||||||| | |||||||| |||||||| ||||| |||| |
|
|
| T |
49040232 |
gaggccaagggtagagtttcaaagggggatagggtgtggcagattgcatttggggcaggttttaaatgtaacagtgccgtatgga |
49040316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 29 - 190
Target Start/End: Original strand, 15239531 - 15239692
Alignment:
| Q |
29 |
aagtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatggtatgaactggcttatactgaggcaaag |
128 |
Q |
| |
|
|||||| |||||||||||||| || ||||||| ||| |||||||||| |||||||| || ||||| | ||||||||| ||||||||||||| || || |
|
|
| T |
15239531 |
aagtgattggcatatggaaccatcaaggatgacactgaatagatttggtaacacttctagtagttcattgtggtatgaattggcttatactgaagctaaa |
15239630 |
T |
|
| Q |
129 |
ggcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaa |
190 |
Q |
| |
|
|| ||| || |||||| ||| | ||||| ||||||||||| || |||||||||||||| |
|
|
| T |
15239631 |
gggaggattaaaaaaggtgatagaacttggcaaattgcatttggttctggttttaagtgtaa |
15239692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 203
Target Start/End: Original strand, 34053231 - 34053404
Alignment:
| Q |
30 |
agtgagtggcatatggaaccgtctcggatgactctgcatagatttggaaacacttcaagcagttctctatggtatgaactggcttatactgaggcaaagg |
129 |
Q |
| |
|
||||| |||||||||||||| || | ||||| || |||||||||| || ||||| || ||||| ||||||||||| ||||||||||||| || || | |
|
|
| T |
34053231 |
agtgattggcatatggaaccatcaagaatgacactaaatagatttggtaatacttctagtagttcattatggtatgaattggcttatactgaagctaaag |
34053330 |
T |
|
| Q |
130 |
gcagggttgcaaaaggggatcgggtctggcagattgcatttgggtcgggttttaagtgtaacagcgccgtgtgg |
203 |
Q |
| |
|
| ||| || |||||| ||| || ||||| ||||||||||| || || ||||| |||||||| || |||||| |
|
|
| T |
34053331 |
ggaggattagaaaaggtgataggacttggcaaattgcatttggttctggatttaaatgtaacagtgctgtgtgg |
34053404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University