View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20551_high_9 (Length: 348)
Name: NF20551_high_9
Description: NF20551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20551_high_9 |
 | |
|
| [»] scaffold0026 (3 HSPs) |
| | |
|
| [»] scaffold1001 (1 HSPs) |
| | |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
| [»] scaffold0024 (2 HSPs) |
| | |
|
| [»] scaffold0160 (3 HSPs) |
| | |
|
| [»] scaffold0535 (2 HSPs) |
| | |
|
| [»] scaffold0001 (2 HSPs) |
| | |
|
| [»] scaffold0210 (2 HSPs) |
| | |
|
| [»] scaffold0005 (6 HSPs) |
| | |
|
| [»] scaffold0712 (1 HSPs) |
| | |
|
| [»] scaffold0709 (1 HSPs) |
| | |
|
| [»] scaffold0065 (2 HSPs) |
| | |
|
| [»] scaffold0056 (5 HSPs) |
| | |
|
| [»] scaffold0684 (2 HSPs) |
| | |
|
| [»] scaffold0370 (1 HSPs) |
| | |
|
| [»] scaffold0373 (1 HSPs) |
| | |
|
| [»] scaffold0021 (2 HSPs) |
| | |
|
| [»] scaffold0811 (2 HSPs) |
| | |
|
| [»] scaffold0176 (3 HSPs) |
| | |
|
| [»] scaffold0051 (2 HSPs) |
| | |
|
| [»] scaffold0337 (1 HSPs) |
| | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
| [»] scaffold0159 (1 HSPs) |
| | |
|
| [»] scaffold0123 (1 HSPs) |
| | |
|
| [»] scaffold0078 (2 HSPs) |
| | |
|
| [»] scaffold0002 (2 HSPs) |
| | |
|
| [»] scaffold0347 (2 HSPs) |
| | |
|
| [»] scaffold0119 (2 HSPs) |
| | |
|
| [»] scaffold0105 (1 HSPs) |
| | |
|
| [»] scaffold0326 (4 HSPs) |
| | |
|
| [»] scaffold0166 (1 HSPs) |
| | |
|
| [»] scaffold0011 (3 HSPs) |
| | |
|
| [»] scaffold0060 (2 HSPs) |
| | |
|
| [»] scaffold0016 (2 HSPs) |
| | |
|
| [»] scaffold0085 (2 HSPs) |
| | |
|
| [»] scaffold0007 (2 HSPs) |
| | |
|
| [»] scaffold0578 (1 HSPs) |
| | |
|
| [»] scaffold0517 (1 HSPs) |
| | |
|
| [»] scaffold0106 (1 HSPs) |
| | |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 256)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 30 - 326
Target Start/End: Complemental strand, 54903638 - 54903342
Alignment:
| Q |
30 |
gaaagaactatggaatcaaacggtgattgcttttatgagcaattgctttctctagatggattcattcagaatagttgtgtgccttggatgacacaataag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54903638 |
gaaagaactatggaatcaaacggtgattgcttttatgagcaattgctttctctagatggattcattcagaatagttgtgtgccttggatgacacaataag |
54903539 |
T |
|
| Q |
130 |
tgaagtggttaaacaggtatgcacgattaaaatattcttgtgttttgttcactttttaaataaggctaagatatggttttggtccctgcaaatatgcccc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54903538 |
tgaagtggttaaacaggtatgcacgattaaaatattcttgtgttttgttcactttttaaataaggctaaaatatggttttggtccctgcaaatatgcccc |
54903439 |
T |
|
| Q |
230 |
gttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
54903438 |
gttttggttttagtccctgtaattttttgttttgtttttggtccctgcaaatatgtctcgttttggttttggtccctctccccacttttgtgatgat |
54903342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 30 - 177
Target Start/End: Complemental strand, 54887504 - 54887356
Alignment:
| Q |
30 |
gaaagaactatggaatcaaacggtgattgcttttatgagcaattgctttctctagatggattcattcagaatagttgtgtgccttggatgacacaataag |
129 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||| | ||||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
54887504 |
gaaagaactatggaatcaaatggtgattgcttttttgagcaattgcttgatgtagatggattcgttcagaatagttctttgccttggatgacacaataag |
54887405 |
T |
|
| Q |
130 |
tgaagtggttaaacaggtatgcacg-attaaaatattcttgtgttttgt |
177 |
Q |
| |
|
||||| |||| | |||||||||||| |||||||||||| |||||||||| |
|
|
| T |
54887404 |
tgaagcggttgagcaggtatgcacgaattaaaatattcatgtgttttgt |
54887356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 51 - 161
Target Start/End: Complemental strand, 54893101 - 54892990
Alignment:
| Q |
51 |
ggtgattgcttttatgagcaattgctttctctagatggattcattcagaatagttgtgtgcctt-ggatgacacaataagtgaagtggttaaacaggtat |
149 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||||| ||||| ||| |||||||||||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
54893101 |
ggtgattgcttttttgagcaactgctagctctagacggattgattgagaatagttgtgtgtctttggatgacacaataagtgaagcggttaaacaggtat |
54893002 |
T |
|
| Q |
150 |
gcacgattaaaa |
161 |
Q |
| |
|
|||||||||| |
|
|
| T |
54893001 |
atacgattaaaa |
54892990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 183 - 248
Target Start/End: Complemental strand, 29499556 - 29499491
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29499556 |
ttttaaataaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 13530715 - 13530655
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13530715 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13530655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 24774043 - 24774103
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24774043 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24774103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 35119290 - 35119350
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35119290 |
aaggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgtaa |
35119350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 43231391 - 43231331
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43231391 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
43231331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 192 - 326
Target Start/End: Original strand, 11692761 - 11692895
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgtt |
291 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
11692761 |
aggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccctataattttttttgttgtttttggtccctgcaaatatgcctcgtt |
11692860 |
T |
|
| Q |
292 |
ttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||| ||||||||| || |||||||||||||||||| |
|
|
| T |
11692861 |
ttgattttggtccctgaccccacttttgtgatgat |
11692895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 188 - 251
Target Start/End: Complemental strand, 52017875 - 52017812
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52017875 |
aataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
52017812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 46115414 - 46115472
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
46115472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 46128548 - 46128606
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
46128606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 189 - 251
Target Start/End: Original strand, 52017501 - 52017563
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52017501 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
52017563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 53308068 - 53308010
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgtaa |
53308010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 25423921 - 25423982
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
25423921 |
taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25423982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 29499180 - 29499237
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29499180 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 30046794 - 30046737
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30046794 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 30061135 - 30061078
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30061135 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 5827975 - 5827915
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
5827975 |
aaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgtaa |
5827915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 13064467 - 13064407
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13064467 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13064407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 16712693 - 16712633
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16712693 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16712633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 25424314 - 25424254
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
25424314 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25424254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 194 - 326
Target Start/End: Original strand, 36050289 - 36050420
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgtttt |
293 |
Q |
| |
|
||||| |||||||||||||||| ||||||||| | ||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgtaattttgtttttgttttt-ggtccctgcaaatatgcctcgtttt |
36050387 |
T |
|
| Q |
294 |
ggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |
|
|
| T |
36050388 |
ggttttggtccctggccccacttttgtgatgat |
36050420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 184 - 248
Target Start/End: Complemental strand, 42848400 - 42848336
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| | |||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42848400 |
tttaaaaatggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 13631227 - 13631286
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13631227 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13631286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 13631603 - 13631544
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
13631603 |
ataaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 14487801 - 14487860
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
14487801 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaa |
14487860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 23245231 - 23245286
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 35464017 - 35464076
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
35464017 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35464076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 35464382 - 35464327
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 13073759 - 13073817
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13073817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 53717174 - 53717116
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
53717116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 2180217 - 2180278
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
2180217 |
taaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
2180278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 4211578 - 4211635
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
4211578 |
ggtccctgcaaatatgcctcgttttggttttggtccctggccccacttttgtgatgat |
4211635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 6353637 - 6353580
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaa |
6353580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 14791808 - 14791751
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
14791808 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 247
Target Start/End: Original strand, 18205153 - 18205210
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18205153 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18205210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 247
Target Start/End: Original strand, 32208539 - 32208596
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32208539 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
32208596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 41345851 - 41345908
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41345851 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41345908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 43231086 - 43231143
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
43231086 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 46292409 - 46292466
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
46292409 |
ggtccctgcaaatatgcctcgttttggttttggtccctgcccccacttttgtgatgat |
46292466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 186 - 251
Target Start/End: Original strand, 55072382 - 55072447
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55072382 |
taaagaaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
55072447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 2034857 - 2034797
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2034857 |
aaggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgtaa |
2034797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 4211560 - 4211616
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
4211560 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
4211616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 9445943 - 9446007
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9445943 |
aaataagactaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
9446007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 29463915 - 29463855
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
29463915 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaa |
29463855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 31812215 - 31812155
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
31812215 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
31812155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 35763646 - 35763702
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35763646 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 36054152 - 36054092
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
36054152 |
aaggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
36054092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 38054544 - 38054604
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38054544 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38054604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 42848025 - 42848085
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
42848025 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
42848085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 53915682 - 53915738
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
53915682 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 2034546 - 2034597
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2034546 |
atatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2034597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 11693122 - 11693063
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
11693122 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgtaa |
11693063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 12152494 - 12152435
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||| |||||||||| |
|
|
| T |
12152494 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgtaa |
12152435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 12791975 - 12791916
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12791975 |
aggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgtaa |
12791916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 13064158 - 13064217
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
13064158 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
13064217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 13074126 - 13074067
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
13074126 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttgtaa |
13074067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 13479612 - 13479553
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13479612 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13479553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 14488188 - 14488129
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
14488188 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
14488129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 200 - 326
Target Start/End: Original strand, 20144427 - 20144553
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgttttggtttt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||| |||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
20144427 |
atatggttttggtccctgcaaatatgcctcgttttagttttagaccctgtaattttttgttttgtttttggtccctgcaaatatgtctcgttttggtttt |
20144526 |
T |
|
| Q |
300 |
ggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| || ||||||||||||||||| |
|
|
| T |
20144527 |
ggtccctgatcccacttttgtgatgat |
20144553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 20291985 - 20292044
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
20291985 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtctctgtaa |
20292044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 23245596 - 23245537
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
23245596 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgtaa |
23245537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 26412584 - 26412529
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 247
Target Start/End: Complemental strand, 29420538 - 29420483
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
29420538 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 35415633 - 35415578
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35415578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 190 - 249
Target Start/End: Original strand, 45505597 - 45505656
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45505597 |
taaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
45505656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 46292392 - 46292447
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 181 - 248
Target Start/End: Complemental strand, 47023117 - 47023050
Alignment:
| Q |
181 |
ctttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
47023117 |
ctttttaaattaggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 51545962 - 51545911
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51545962 |
atatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
51545911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 5827655 - 5827713
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
5827713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 6827877 - 6827819
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6827877 |
taaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
6827819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 13764613 - 13764671
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgtaa |
13764671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 19321859 - 19321801
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaa |
19321801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 22099543 - 22099601
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
22099601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 26313988 - 26314046
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgtaa |
26314046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 31560695 - 31560637
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
31560637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 183 - 249
Target Start/End: Original strand, 32365084 - 32365150
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||| | ||||||| |||||||||| ||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
32365084 |
ttttaatttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
32365150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 191 - 249
Target Start/End: Complemental strand, 32365485 - 32365427
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
32365485 |
aaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
32365427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 41324890 - 41324832
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||| || ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgtaa |
41324832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 191 - 249
Target Start/End: Complemental strand, 45505896 - 45505838
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
45505896 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
45505838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 189 - 251
Target Start/End: Original strand, 51545625 - 51545687
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||| || |||||||||||||||| |||||| |
|
|
| T |
51545625 |
ataaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctctgtaa |
51545687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 2322094 - 2322151
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgtaa |
2322151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 187 - 244
Target Start/End: Original strand, 6827540 - 6827597
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||||| |||||||||| |||| |||||||||||| |||||||||||||||| |
|
|
| T |
6827540 |
aaataaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 11285504 - 11285561
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11285561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 186 - 251
Target Start/End: Complemental strand, 13764814 - 13764749
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
13764814 |
taaataaggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtccatgtaa |
13764749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 22099915 - 22099854
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
22099915 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaa |
22099854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 31560329 - 31560386
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31560329 |
aaggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 31811922 - 31811983
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31811922 |
taaggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgtaa |
31811983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 36701997 - 36702058
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
36701997 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
36702058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 37557194 - 37557137
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||||||||||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgtaa |
37557137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 44925844 - 44925787
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgtaa |
44925787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 51738394 - 51738337
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| || | |||||||||||||||| |
|
|
| T |
51738394 |
ggtccatgcaaatatgcctcgttttgattttggtccctgactccacttttgtgatgat |
51738337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 123533 - 123589
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
123533 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
123589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 2322434 - 2322374
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
2322434 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgtaa |
2322374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 5052586 - 5052526
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
5052586 |
aaggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
5052526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 8760783 - 8760723
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
8760783 |
aaggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgtaa |
8760723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 9289265 - 9289321
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
9289265 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 15555510 - 15555558
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15555510 |
atatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 19903653 - 19903597
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgtaa |
19903597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 243
Target Start/End: Original strand, 23778962 - 23779014
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
23778962 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 247
Target Start/End: Complemental strand, 24474965 - 24474909
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
24474965 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 26314334 - 26314274
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||||| | ||||||||||||||||||||||| |
|
|
| T |
26314334 |
aaggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgtaa |
26314274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 26412189 - 26412245
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
26412189 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 193 - 249
Target Start/End: Original strand, 27008084 - 27008140
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27008140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 247
Target Start/End: Complemental strand, 28809182 - 28809126
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28809182 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 29380912 - 29380852
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
29380912 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
29380852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 30060776 - 30060824
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
30060776 |
atatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 34361801 - 34361861
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
34361801 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
34361861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 41619906 - 41619954
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41619906 |
atatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41619954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 46088061 - 46088005
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
46088061 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 46292653 - 46292593
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
46292653 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgtaa |
46292593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 187 - 247
Target Start/End: Original strand, 47022734 - 47022794
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| ||| ||||||||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
47022734 |
aaataaggataaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 52442094 - 52442034
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
52442094 |
aaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
52442034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 53916048 - 53915992
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
53916048 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 54208827 - 54208767
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
54208827 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
54208767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 5882551 - 5882609
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5882551 |
aggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctgtaa |
5882609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 12152153 - 12152212
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
12152153 |
aggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgtaa |
12152212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 269 - 328
Target Start/End: Complemental strand, 14594490 - 14594431
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgatgt |
328 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
14594490 |
ggtccctgcaaatatgtctcgttttggttttggtccctagccccacttttgtgatgatgt |
14594431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 14791506 - 14791557
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
14791506 |
atatggttttggtccctgcaaatatgcctcattttggttttagtctctgtaa |
14791557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 27008399 - 27008348
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27008399 |
atatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
27008348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 41620260 - 41620201
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||||||| ||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
41620260 |
ataaggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
41620201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 42823775 - 42823834
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
42823775 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgtaa |
42823834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 50714240 - 50714295
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50714295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 50714565 - 50714510
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
50714510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 51738136 - 51738195
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| | ||||||||||||| ||||||||| |
|
|
| T |
51738136 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgtaa |
51738195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 52430101 - 52430042
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
52430101 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaa |
52430042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 52441762 - 52441821
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
52441762 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
52441821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 55072705 - 55072654
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
55072705 |
atatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
55072654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 8191391 - 8191333
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaa |
8191333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 191 - 241
Target Start/End: Original strand, 8904884 - 8904934
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8904884 |
aaggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 189 - 251
Target Start/End: Complemental strand, 20144735 - 20144673
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||||||| ||||||||||||| |||||||| |
|
|
| T |
20144735 |
ataaggctaaaatatggttttggttcatgcaaatatgcctcgttttggttttaacccctgtaa |
20144673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 55482468 - 55482410
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| |||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgtaa |
55482410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 5797743 - 5797686
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
5797743 |
ggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgat |
5797686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 7642576 - 7642519
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
7642576 |
ggtccctgcaaatatgtctcattttggttttggtccctgaccccacttttgtgatgat |
7642519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 8760601 - 8760662
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
8760601 |
taaggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgtaa |
8760662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 8905158 - 8905101
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||| ||||||| ||||| |||||||||||| |
|
|
| T |
8905158 |
ggtccctgcaaatatgtctcgttttggttttcgtccatggccccatttttgtgatgat |
8905101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 13530456 - 13530513
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
13530456 |
ggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgat |
13530513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 14791789 - 14791732
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
14791789 |
ggtccctgcaaatatgtctcgttttggttttagtccctgaccccacttttgtgatgat |
14791732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 24774350 - 24774293
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
24774350 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
24774293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 25424235 - 25424178
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
25424235 |
ggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgat |
25424178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 26314067 - 26314124
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
26314067 |
ggtccctgaaaatatgtctcgttttggttttggtccatgactccacttttgtgatgat |
26314124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 247
Target Start/End: Complemental strand, 32208904 - 32208847
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
32208904 |
taaggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 36702362 - 36702305
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| || |||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgtaa |
36702305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 244
Target Start/End: Original strand, 44925483 - 44925536
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
44925483 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 45474599 - 45474538
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||| || ||||||||||||| |||||| |
|
|
| T |
45474599 |
taaggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctctgtaa |
45474538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 46115781 - 46115724
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
46115781 |
aaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 46128915 - 46128858
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
46128915 |
aaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 47135855 - 47135912
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
47135855 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
47135912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 47136170 - 47136113
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | | ||||||||||||||| ||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaa |
47136113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 187 - 244
Target Start/End: Original strand, 51708687 - 51708744
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
51708687 |
aaattaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 244
Target Start/End: Complemental strand, 51709029 - 51708976
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| | |||||||||||||| |
|
|
| T |
51709029 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 51763125 - 51763068
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
51763125 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
51763068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 51763201 - 51763144
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| | ||||||||||||| ||||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctgtaa |
51763144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 54208748 - 54208691
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
54208748 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
54208691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 5202933 - 5202981
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccg-ttttggttttagtccct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
5202933 |
atatggttttggtccctgcaaatatgcctcgtttttggttttagtccct |
5202981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 278 - 326
Target Start/End: Original strand, 5827741 - 5827789
Alignment:
| Q |
278 |
aaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||| ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
5827741 |
aaatatgtctcgttttggttttggtccctgaccccacttttgtgatgat |
5827789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 9289632 - 9289584
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
9289632 |
atatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 13530378 - 13530434
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
13530378 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 18205521 - 18205465
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
18205465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 19321569 - 19321625
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||| |||||||||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
19321569 |
aggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 270 - 326
Target Start/End: Complemental strand, 25358491 - 25358435
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||| |||||||||||| |||||| || |||||||||||||||||| |
|
|
| T |
25358491 |
gtccctgcaaatatgtctcgttttggttgtggtccctgaccccacttttgtgatgat |
25358435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 176 - 248
Target Start/End: Original strand, 29380652 - 29380723
Alignment:
| Q |
176 |
gttcactttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| |||||||| |||||||| |||| ||||| ||||||||||||||| | |||||||||||| ||||||| |
|
|
| T |
29380652 |
gttcattttttaaa-aaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctg |
29380723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 29380686 - 29380742
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||| || |||||||||||| ||||| |
|
|
| T |
29380686 |
gtccctgcaaatatgtctcgttttggttttggtccctggccccacttttgtaatgat |
29380742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 35415298 - 35415354
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
35415298 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
35415354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 35420701 - 35420645
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||||||||||| |||||||||| | || |||||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgtaa |
35420645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 35763956 - 35763900
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||| |||| ||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
35763956 |
aggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctg |
35763900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 43368467 - 43368523
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
43368523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 45593222 - 45593286
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||| |||| ||||| |||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
45593222 |
aaattaggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgtaa |
45593286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 270 - 326
Target Start/End: Complemental strand, 50754177 - 50754121
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||| || |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
50754177 |
gtccctgcaaatatgtcttgttttggttttggtccctgaccccacttttgtgatgat |
50754121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 51738412 - 51738356
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||| ||||||| |||| ||||||| |
|
|
| T |
51738412 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 51762868 - 51762928
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||| |||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
51762868 |
aaggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgtaa |
51762928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 5797488 - 5797539
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||| ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
5797488 |
atatgattttggtctctgcaaatatgtctcgttttggttttagtccctgtaa |
5797539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 12791891 - 12791840
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||| |||||||||||||||||| || || ||||||||||||||| |
|
|
| T |
12791891 |
tgcaaatatgcatcgttttggttttggtccctgacctcacttttgtgatgat |
12791840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 22584286 - 22584345
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||| | |||||||||||||||| |||||| |
|
|
| T |
22584286 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctgtaa |
22584345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 22584608 - 22584549
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| || ||||||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22584608 |
aggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgtaa |
22584549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 190 - 249
Target Start/End: Complemental strand, 23779228 - 23779169
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
23779228 |
taaggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgt |
23779169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 25358540 - 25358485
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||| |||||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 34355284 - 34355225
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||| | ||||||||||||||||||||||| |
|
|
| T |
34355284 |
aggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgtaa |
34355225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 195 - 250
Target Start/End: Original strand, 35420393 - 35420448
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgta |
35420448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 45593587 - 45593528
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
45593587 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgtaa |
45593528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 47532665 - 47532614
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||| |||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
47532665 |
atatggttttggtccttgcaaatatgtctcgttttggttttagttcctgtaa |
47532614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 190 - 241
Target Start/End: Original strand, 52543419 - 52543470
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
52543419 |
taaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 53716920 - 53716979
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
53716920 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtaa |
53716979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 246
Target Start/End: Complemental strand, 123891 - 123845
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccc |
246 |
Q |
| |
|
|||||||||| ||||||||||||||||| | |||||||||||||||| |
|
|
| T |
123891 |
atatggttttagtccctgcaaatatgcctcattttggttttagtccc |
123845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 2180572 - 2180514
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtccttgtaa |
2180514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 250
Target Start/End: Original strand, 4279021 - 4279079
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
||||||| |||||||||| | |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
4279021 |
aggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgta |
4279079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 4279335 - 4279277
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttgtaa |
4279277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 27427869 - 27427926
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| ||||||||| | |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
27427869 |
taaggctaaaatatggtttag-tccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 28809011 - 28809069
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgtaa |
28809069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 42824091 - 42824033
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||| ||||||||| ||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtccttgtaa |
42824033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 5203216 - 5203159
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| || | |||||||||||||||| |
|
|
| T |
5203216 |
ggtccctgcaaatatgcctcattttggttttggtctctggctccacttttgtgatgat |
5203159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 247
Target Start/End: Original strand, 13479273 - 13479326
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| | ||||||||||||| ||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct |
13479326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 192 - 245
Target Start/End: Original strand, 14594205 - 14594258
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
14594205 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 28449217 - 28449156
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||| | ||||||| ||||| ||| ||||| |
|
|
| T |
28449217 |
taaggctaaaatatggttttggtccttgcaaatatgtctcgttttgattttaatccatgtaa |
28449156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 31812000 - 31812057
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||| ||||||| |
|
|
| T |
31812000 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttatgatgat |
31812057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 192 - 245
Target Start/End: Complemental strand, 35119612 - 35119559
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| | ||||||||||| ||||| |
|
|
| T |
35119612 |
aggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 192 - 245
Target Start/End: Complemental strand, 41346219 - 41346166
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | | ||||||||||||||| |
|
|
| T |
41346219 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
41346166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 41439865 - 41439922
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| || ||||| |||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
41439865 |
ggtccttgtaaataagcctcgttttggttttggcccatgaccctacttttgtgatgat |
41439922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 44925766 - 44925709
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| ||| | |||||||||||||||| |
|
|
| T |
44925766 |
ggtccctgcaaatatgcctaattttggttttggtctatggcgccacttttgtgatgat |
44925709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 46115702 - 46115645
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
46115702 |
ggtccctgcaaatatgccttattttggttttggtccctggctccacttttgtgatgat |
46115645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 46128836 - 46128779
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
46128836 |
ggtccctgcaaatatgccttattttggttttggtccctggctccacttttgtgatgat |
46128779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 47023028 - 47022971
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||| ||||||| |
|
|
| T |
47023028 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttttgatgat |
47022971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 50753919 - 50753980
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
50753919 |
taaggttaaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgtaa |
50753980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 5797813 - 5797765
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||||||||| |||||||| | ||||||||||||| |||||| |
|
|
| T |
5797813 |
atatggttttggtccctacaaatatgtctcgttttggttttaatccctg |
5797765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 16712331 - 16712387
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtctctgtaa |
16712387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 18136115 - 18136055
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| ||| ||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
18136115 |
aaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgtaa |
18136055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 18831176 - 18831120
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgtaa |
18831120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 244
Target Start/End: Original strand, 28448833 - 28448885
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| |||||||||| |||| | |||||||||| |||||||||||||||| |
|
|
| T |
28448833 |
aggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 31182506 - 31182446
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| | |||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
31182506 |
aaggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgtaa |
31182446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 49123323 - 49123263
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| ||| ||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
49123323 |
aaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgtaa |
49123263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 270 - 326
Target Start/End: Complemental strand, 52543651 - 52543595
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||| ||| ||||| |||||||||||| |||||||||| ||||||| |
|
|
| T |
52543651 |
gtccctgcaaatatgtctcattttgattttggtccatgaccccacttttctgatgat |
52543595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 251
Target Start/End: Original strand, 54208479 - 54208519
Alignment:
| Q |
211 |
gtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
54208479 |
gtccctgcaaatatgcctcattttggttttagtccctgtaa |
54208519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 12152410 - 12152359
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
12152410 |
tgcaaatatgtttcgttttggttttggtctctgaccccacttttgtgatgat |
12152359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 269 - 304
Target Start/End: Original strand, 14487819 - 14487854
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtcc |
304 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14487819 |
ggtccctgcaaatatgcctcgttttggttttggtcc |
14487854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 189 - 244
Target Start/End: Complemental strand, 15555642 - 15555587
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||| ||||| |||| ||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
15555642 |
ataaagctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 19903260 - 19903319
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||| |||||| |||||||||||||| | | ||||| ||||||||||||||| |
|
|
| T |
19903260 |
aggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgtaa |
19903319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 19903344 - 19903395
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| || || ||||||||||||||| |
|
|
| T |
19903344 |
tgcaaatatgtctcattttggttttggtccctggccacacttttgtgatgat |
19903395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 24474599 - 24474657
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||| ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtccatgtaa |
24474657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 195 - 250
Target Start/End: Original strand, 30564835 - 30564890
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgta |
30564890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 35420476 - 35420527
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
35420476 |
tgcaaatatgtctcattttggttttggtccttggctccacttttgtgatgat |
35420527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 37556840 - 37556899
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| | || ||||||||| || || |||||||||||||||||||| |
|
|
| T |
37556840 |
aggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgtaa |
37556899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 190 - 245
Target Start/End: Complemental strand, 41921087 - 41921032
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||||| |||||||||| | ||||||||||||| ||||||||||||||||| |
|
|
| T |
41921087 |
taaggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 5797747 - 5797705
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
5797747 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
5797705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 7642652 - 7642594
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| || ||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7642652 |
ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctgtaa |
7642594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 8905234 - 8905176
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||| | ||||| ||||| ||||| ||| |
|
|
| T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccctttaa |
8905176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 9446323 - 9446265
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| ||||||| ||||||| | |||||||||||| |||||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgtaa |
9446265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 13530452 - 13530494
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
13530452 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
13530494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 23245308 - 23245362
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
23245308 |
ggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgat |
23245362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 24774354 - 24774312
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
24774354 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24774312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 25424239 - 25424197
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
25424239 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
25424197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 26412507 - 26412453
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
26412507 |
ggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgat |
26412453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 304
Target Start/End: Complemental strand, 29463895 - 29463861
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtcc |
304 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
29463895 |
gtccctgcaaatatgcctcgttttggttttggtcc |
29463861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 31560408 - 31560462
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
31560408 |
ggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgat |
31560462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 31811996 - 31812038
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
31811996 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
31812038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 35464305 - 35464251
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
35464305 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
35464251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 42848314 - 42848260
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
42848314 |
ggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgat |
42848260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 47135851 - 47135893
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
47135851 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
47135893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 51763129 - 51763087
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
51763129 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
51763087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 53915760 - 53915814
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
53915760 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
53915814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 2322355 - 2322298
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||| ||| || ||| |||||||||||||| |
|
|
| T |
2322355 |
ggtccctgcaaatatgtctcgttttggttttcgtctctggccctacttttgtgatgat |
2322298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 7639897 - 7639954
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| | |||||||||||| || |||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggttttaatctctgtaa |
7639954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 9836908 - 9836957
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||| | ||||||| ||||||||| ||||||||||||| ||||||| |
|
|
| T |
9836908 |
caaatatgtcacgttttgattttggtccctgtccccacttttatgatgat |
9836957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 13073837 - 13073894
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||| |||||||||||||| ||| || |||||||||||||||||| |
|
|
| T |
13073837 |
ggtccctgcaaatatatctcgttttggttttcgtctctggccccacttttgtgatgat |
13073894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 14488110 - 14488053
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||||| || | ||| |||||||||||| |
|
|
| T |
14488110 |
ggtccctgcaaatatgcttcattttggttttggtccctgacaccaattttgtgatgat |
14488053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #246
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 14594494 - 14594453
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
14594494 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
14594453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #247
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 33137293 - 33137232
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||||||| | |||| |||||||||||||| |
|
|
| T |
33137293 |
aaataaggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttagtccctg |
33137232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #248
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 326
Target Start/End: Complemental strand, 37557110 - 37557061
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||| |||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
37557110 |
caaatgtgcatcgttttggttttggtcctagtcctcacttttgtgatgat |
37557061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #249
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 53307831 - 53307888
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||| ||| || || ||||||||||||||| |
|
|
| T |
53307831 |
ggtccctgcaaatatgtctcgttttggttttcgtctctgacctcacttttgtgatgat |
53307888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #250
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 55805011 - 55804954
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||| || | |||||||||||||||| |
|
|
| T |
55805011 |
ggtccctgcaaatatgcatcattttggttttggtcgttggctccacttttgtgatgat |
55804954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #251
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 2034781 - 2034741
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccc |
246 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||||||||| |
|
|
| T |
2034781 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
2034741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #252
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 270 - 326
Target Start/End: Complemental strand, 20292240 - 20292184
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| || | |||||||||||||||| |
|
|
| T |
20292240 |
gtccatgcaaatatgcctcattttaattttggtctctgactccacttttgtgatgat |
20292184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #253
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
|||||| |||||||||| | |||||||||||||| ||||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #254
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 51830891 - 51830947
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||| ||||| ||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctgtaa |
51830947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #255
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 52543725 - 52543669
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||| ||||||| | |||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggttttaatccatgtaa |
52543669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #256
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 245
Target Start/End: Complemental strand, 55805088 - 55805036
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||| |||| |||||||| | |||||||||||| |||||||||||||||| |
|
|
| T |
55805088 |
ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtcc |
55805036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 4e-23; HSPs: 211)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 188 - 251
Target Start/End: Original strand, 16522986 - 16523049
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16522986 |
aataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16523049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 2481560 - 2481499
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2481560 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2481499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 4423892 - 4423953
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4423892 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4423953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 29859875 - 29859814
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29859875 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29859814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 16523326 - 16523267
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16523326 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16523267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 15842826 - 15842768
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15842826 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 189 - 251
Target Start/End: Original strand, 18113085 - 18113147
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18113085 |
ataaggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgtaa |
18113147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 14003744 - 14003687
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14003744 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 20131687 - 20131626
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20131687 |
aaatatggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 33732859 - 33732920
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33732859 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
33732920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 4424187 - 4424127
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
4424187 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4424127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 24358615 - 24358671
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24358615 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 24483893 - 24483833
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24483893 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24483833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 25705083 - 25705143
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
25705083 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25705143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 25705450 - 25705394
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25705450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 188 - 248
Target Start/End: Complemental strand, 37272107 - 37272047
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37272107 |
aataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37272047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 5334751 - 5334806
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 5335040 - 5334985
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 13215059 - 13215118
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13215059 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13215118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 16900210 - 16900151
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16900210 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16900151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 16993601 - 16993542
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16993601 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16993542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 188 - 251
Target Start/End: Original strand, 38731824 - 38731887
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38731824 |
aataaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38731887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 44559061 - 44559120
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
44559061 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
44559120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 34317798 - 34317856
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
34317856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 190 - 326
Target Start/End: Complemental strand, 37911123 - 37910986
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt-aannnnnnnnnnnnnnnnnggtccatgcaaatatgcctc |
288 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
37911123 |
taaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgtaaaatttttttgttgtttttggtccatgcaaatatgcctc |
37911024 |
T |
|
| Q |
289 |
gttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||||||| || | |||||||||||||||| |
|
|
| T |
37911023 |
attttggttttggtccctgactccacttttgtgatgat |
37910986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 195 - 248
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 19184153 - 19184096
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19184153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19184096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 20939324 - 20939267
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
20939267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 22881610 - 22881671
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
22881610 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
22881671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 24358947 - 24358890
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24358947 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 26814231 - 26814174
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26814231 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26814174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 30215420 - 30215477
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30215420 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 33576119 - 33576062
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
33576119 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 37271737 - 37271794
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37271737 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37271794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 38980255 - 38980198
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38980255 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38980198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 1137983 - 1138039
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaa |
1138039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 183 - 251
Target Start/End: Original strand, 3172010 - 3172078
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||| ||||| |||||||||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
3172010 |
ttttaaaaaaggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtccatgtaa |
3172078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 8046327 - 8046387
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8046327 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaa |
8046387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 11713847 - 11713787
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||| |||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11713847 |
aaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11713787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 14003408 - 14003464
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14003408 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 15842468 - 15842516
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15842468 |
atatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 16673772 - 16673716
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
16673772 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 17302145 - 17302085
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
17302145 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
17302085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 20131316 - 20131372
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
20131316 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 29859494 - 29859542
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29859494 |
atatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 31644839 - 31644899
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
31644839 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
31644899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 32476093 - 32476153
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
32476093 |
aaggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgtaa |
32476153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 41451836 - 41451892
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
41451836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 42358697 - 42358757
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42358697 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
42358757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 44985623 - 44985679
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44985679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 9195207 - 9195148
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| | ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9195207 |
aggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgtaa |
9195148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 10671629 - 10671688
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
10671629 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgtaa |
10671688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 11788417 - 11788358
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
11788417 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
11788358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 30215872 - 30215813
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
30215872 |
aggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgtaa |
30215813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 36806889 - 36806838
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
36806889 |
atatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36806838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 40302340 - 40302281
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
40302340 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgtaa |
40302281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 43592045 - 43592104
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43592045 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
43592104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 43597153 - 43597212
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| || |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43597153 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaa |
43597212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 146690 - 146632
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaa |
146632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 181 - 251
Target Start/End: Complemental strand, 3838275 - 3838206
Alignment:
| Q |
181 |
ctttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||| |||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3838275 |
ctttgtaaataag-ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
3838206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 191 - 245
Target Start/End: Original strand, 4042608 - 4042662
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
4042608 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 8046648 - 8046590
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
8046590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 11713485 - 11713543
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
11713543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 247
Target Start/End: Original strand, 27109073 - 27109127
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 36622250 - 36622308
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36622308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 189 - 251
Target Start/End: Complemental strand, 36815839 - 36815777
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
36815839 |
ataaggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgtaa |
36815777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 40124966 - 40125024
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| | ||||||||||||| ||||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgtaa |
40125024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 41694003 - 41693945
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
41693945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 247
Target Start/End: Original strand, 42695868 - 42695922
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 44073810 - 44073752
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
44073810 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
44073752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 200 - 249
Target Start/End: Complemental strand, 3671185 - 3671136
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3671185 |
atatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3671136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 10374775 - 10374832
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
10374832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 16673409 - 16673466
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | | |||||||||||||||||| |
|
|
| T |
16673409 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 17541380 - 17541437
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
17541380 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
17541437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 19183780 - 19183837
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
19183780 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19183837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 29865222 - 29865279
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29865279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 40125292 - 40125231
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||| | |||| |||||||||||||||| |
|
|
| T |
40125292 |
taaggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaa |
40125231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 42696202 - 42696145
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccatgtaa |
42696145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 192 - 245
Target Start/End: Original strand, 43788857 - 43788910
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43788857 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43788910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 3172534 - 3172474
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3172534 |
aaggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtccatgtaa |
3172474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 183 - 251
Target Start/End: Original strand, 16968542 - 16968610
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| ||| |||||||||| |||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
16968542 |
ttttaattaaggttaaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgtaa |
16968610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 23732330 - 23732271
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
23732330 |
aaggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctgtaa |
23732271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 27310874 - 27310933
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27310874 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctgtaa |
27310933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 33575751 - 33575807
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
33575751 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 37228731 - 37228791
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
37228731 |
aaggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctgtaa |
37228791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 40301973 - 40302033
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| | |||| |||||||||||||||| |
|
|
| T |
40301973 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaa |
40302033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 41693672 - 41693732
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41693672 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
41693732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 44559407 - 44559351
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
44559351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 1138360 - 1138301
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
1138360 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaa |
1138301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 5790558 - 5790613
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||||| || ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
5790613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 10671942 - 10671883
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
10671942 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
10671883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 20658060 - 20658119
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| | |||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20658060 |
aggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
20658119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 26813866 - 26813921
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26813921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 247
Target Start/End: Complemental strand, 27311070 - 27311015
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
27311070 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 29865512 - 29865453
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29865512 |
aggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaa |
29865453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 31909479 - 31909421
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
31909479 |
aggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtctctgtaa |
31909421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 44985985 - 44985926
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
44985985 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
44985926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 1497610 - 1497668
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaa |
1497668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 10375069 - 10375011
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgtaa |
10375011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 12835325 - 12835383
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
12835383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 18113454 - 18113396
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgtaa |
18113396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 31226077 - 31226019
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgtaa |
31226019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 247
Target Start/End: Complemental strand, 33733241 - 33733187
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 34318083 - 34318025
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtccttgtaa |
34318025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 34964159 - 34964101
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||| ||||||| |||||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgtaa |
34964101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 43789195 - 43789137
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||| || ||||||||||||| |||||||||||||||||||| |
|
|
| T |
43789195 |
taaggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg |
43789137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 1138059 - 1138116
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
1138059 |
ggtccctgcaaatatgtctcgttttggttttggtccccgaccccacttttgtgatgat |
1138116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 2265400 - 2265339
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||| |||| |||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2265400 |
taaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
2265339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 2481191 - 2481248
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||||||||||| | |||||||||| | |||||||||||||||||||| |
|
|
| T |
2481191 |
aaggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 3671002 - 3671059
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||| ||||||| ||||||||||||| |
|
|
| T |
3671002 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt |
3671059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 4423972 - 4424029
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
4423972 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
4424029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 7814244 - 7814301
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||| ||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
7814244 |
aaggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg |
7814301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 249
Target Start/End: Complemental strand, 7814738 - 7814681
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
7814738 |
aggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
7814681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 193 - 250
Target Start/End: Original strand, 9195054 - 9195111
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||| |||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
9195111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 16523066 - 16523123
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||| || | |||||||||||||||| |
|
|
| T |
16523066 |
ggtccctgcaaatatgcctcgtttaggttttggtccctggcgccacttttgtgatgat |
16523123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 24483401 - 24483458
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||| ||| |||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
24483458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 25954429 - 25954368
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||| |||||||||| |||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
25954429 |
taaggttaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaa |
25954368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 29831889 - 29831946
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| | ||||| | ||||||||||||| |
|
|
| T |
29831889 |
ggtccctgcaaatatgcctcgttttggttttggtacgtgtcctcgcttttgtgatgat |
29831946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 34317875 - 34317932
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
34317875 |
ggtccctgcaaatatgcctcattttggttttggtctctggccccacttttgtgatgat |
34317932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 37228799 - 37228856
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||| || ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
37228799 |
ggtccctgcaaatgtgtctcgttttggttttggtccctgaccccacttttgtgatgat |
37228856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 42695945 - 42696002
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
42695945 |
ggtccctgcaaatatgtctcattttggttttggtccttggccccacttttgtgatgat |
42696002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 43597502 - 43597441
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||| |||| |||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
43597502 |
taaggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaa |
43597441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 43671931 - 43671992
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
43671931 |
taaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgtaa |
43671992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 43710711 - 43710650
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||| |||| | || |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43710711 |
taaggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgtaa |
43710650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 3837931 - 3837991
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
3837931 |
aaggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgtaa |
3837991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 193 - 245
Target Start/End: Complemental strand, 4042890 - 4042838
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||| | ||||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 244
Target Start/End: Original strand, 23989837 - 23989889
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
23989837 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 26238811 - 26238871
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
26238811 |
aaggttaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
26238871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 26239161 - 26239105
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
26239161 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 31225713 - 31225773
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||||||| ||||||| ||||||| ||||||| |
|
|
| T |
31225713 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgtaa |
31225773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 31326254 - 31326194
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| ||||| |||| |||||||||||| |||||| |||||||||||||||| |
|
|
| T |
31326254 |
aaggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaa |
31326194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 244
Target Start/End: Original strand, 38639411 - 38639463
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
38639411 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 41791020 - 41791076
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaa |
41791076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 43672320 - 43672260
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43672320 |
aaggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgtaa |
43672260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 4794466 - 4794415
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||| |||||||| | |||||||||||||||| |||||| |
|
|
| T |
4794466 |
atatggttttggtccctacaaatatgtctcgttttggttttagtctctgtaa |
4794415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 10664983 - 10665042
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||| | ||||||||||||| |
|
|
| T |
10664983 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgtaa |
10665042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 13850877 - 13850826
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
13850877 |
atatggttttggttcctgcaaatatgcttcgttttggttttagtctctgtaa |
13850826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 190 - 245
Target Start/End: Complemental strand, 17541779 - 17541724
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
17541779 |
taaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
17541724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 26707872 - 26707931
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26707872 |
aggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgtaa |
26707931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 32691312 - 32691371
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| || ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
32691312 |
aggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgtaa |
32691371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 34964078 - 34964027
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||| ||||| |
|
|
| T |
34964078 |
tgcaaatatgcctcgttttggttttggtctctggccccacttttgtaatgat |
34964027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 191 - 250
Target Start/End: Complemental strand, 35155621 - 35155562
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| | |||||| |||||||||||||| |
|
|
| T |
35155621 |
aaggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgta |
35155562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 37910755 - 37910814
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||||||| | |||| |||||||||||||||| |
|
|
| T |
37910755 |
aggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgtaa |
37910814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 40786459 - 40786518
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| || ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
40786459 |
aggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgtaa |
40786518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 23732039 - 23732097
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| ||||| |||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccatgtaa |
23732097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 31325920 - 31325978
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||| | |||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgtaa |
31325978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 41791312 - 41791254
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| ||||||||||| |||| |||||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtctctgtaa |
41791254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 195 - 248
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| |||||||||| ||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 4794207 - 4794264
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||| ||||||| |
|
|
| T |
4794207 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttatgatgat |
4794264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 247
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||| |||||||||||| |||||||||||| | ||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 5164419 - 5164362
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| || | ||||||||||||||| |
|
|
| T |
5164419 |
ggtccatgcaaatatgtctcgttttggttttggtctctggtctcacttttgtgatgat |
5164362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 13215348 - 13215291
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
13215348 |
ggtccctgcaaatatgtctcgttttggttttggtcattgaccccacttttatgatgat |
13215291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 18113166 - 18113223
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| || | |||||||||||||||| |
|
|
| T |
18113166 |
ggtccctgcaaatatgcctcattttggttttggtcactggctccacttttgtgatgat |
18113223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 23732252 - 23732195
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
23732252 |
ggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgatgat |
23732195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 29182245 - 29182302
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| || | |||||||||||||||| |
|
|
| T |
29182245 |
ggtccatgcaaatatgtatcgttttggttttcgtccctgactccacttttgtgatgat |
29182302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 31909402 - 31909345
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| || ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
31909402 |
ggtccctgcaaatatgtctaattttggttttggtccctggccccacttttgtgatgat |
31909345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 200 - 245
Target Start/End: Original strand, 35155299 - 35155344
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
35155299 |
atatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 35155369 - 35155426
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| || ||||||||||| |||||| |
|
|
| T |
35155369 |
ggtccctgcaaatatgcttcgttttggttttggtctctgaccccacttttgggatgat |
35155426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 40125043 - 40125100
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
40125043 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgatgat |
40125100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 3832349 - 3832405
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||| ||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
3832349 |
gtccctgcaaatatgtctcattttggttttggtctctggccccacttttgtgatgat |
3832405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 244
Target Start/End: Complemental strand, 3832630 - 3832586
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3832630 |
atatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 10665296 - 10665236
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| ||||| ||| |||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
10665296 |
aaggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgtaa |
10665236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 240
Target Start/End: Complemental strand, 13215366 - 13215318
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
13215366 |
aggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 244
Target Start/End: Complemental strand, 17912804 - 17912760
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
17912804 |
atatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 251
Target Start/End: Complemental strand, 22881950 - 22881910
Alignment:
| Q |
211 |
gtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccctgtaa |
22881910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 25299747 - 25299803
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||| |||||||||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctgtaa |
25299803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 25954113 - 25954173
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
25954113 |
aaggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtccttgtaa |
25954173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 195 - 243
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 44994063 - 44994003
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| | |||||| ||||||||| |||||| |
|
|
| T |
44994063 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtctctgtaa |
44994003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 245
Target Start/End: Complemental strand, 45442700 - 45442644
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||||||| ||||| |||| |||| |||||||||| | ||||||||||||||||| |
|
|
| T |
45442700 |
ataaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 269 - 304
Target Start/End: Original strand, 1137998 - 1138033
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtcc |
304 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1137998 |
ggtccctgcaaatatgcctcgttttggttttggtcc |
1138033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 1295540 - 1295489
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||| | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1295540 |
atatggttttgattcctgcaaatatgtttcgttttggttttagtccctgtaa |
1295489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 269 - 308
Target Start/End: Complemental strand, 3172515 - 3172476
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgt |
308 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
3172515 |
ggtccttgcaaatatgcctcgttttggttttagtccatgt |
3172476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 7121034 - 7121085
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
7121034 |
tgcaaatatgtctcattttggttttggtccatggtctcacttttgtgatgat |
7121085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 13850521 - 13850580
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||| |||||| || ||||||||||| | || |||||||||||||||||||| |
|
|
| T |
13850521 |
aggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgtaa |
13850580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 36815487 - 36815546
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| | ||| ||||||| | ||||||||||||||||||||||| |
|
|
| T |
36815487 |
aggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgtaa |
36815546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 146403 - 146457
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
146403 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
146457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 2481270 - 2481324
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
2481270 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
2481324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 4423968 - 4424010
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
4423968 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4424010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 4794203 - 4794245
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
4794203 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4794245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 16523062 - 16523104
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| ||||||| |
|
|
| T |
16523062 |
ttttggtccctgcaaatatgcctcgtttaggttttggtccctg |
16523104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 16673488 - 16673542
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
16673488 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
16673542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 24358868 - 24358814
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
24358868 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
24358814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 213 - 251
Target Start/End: Complemental strand, 26708184 - 26708146
Alignment:
| Q |
213 |
ccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
26708184 |
ccctgcaaatacgcctcgttttggttttagtccctgtaa |
26708146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 304
Target Start/End: Complemental strand, 27311051 - 27311017
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtcc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
27311051 |
gtccatgcaaatatgcctcgttttggttttagtcc |
27311017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 240
Target Start/End: Original strand, 29831885 - 29831919
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
29831885 |
ttttggtccctgcaaatatgcctcgttttggtttt |
29831919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 30215499 - 30215553
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
30215499 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
30215553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 38231431 - 38231489
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| ||||| ||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
38231431 |
ggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgtaa |
38231489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 43672009 - 43672063
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||||||||||||| |||| || ||||||||||||||| |
|
|
| T |
43672009 |
ggtccctgcaaatatgtttcgttttggttttcgtccctggccccacttttgtgat |
43672063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 326
Target Start/End: Complemental strand, 4042805 - 4042756
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||| ||||||||||||||| || | ||||||||||||||| |
|
|
| T |
4042805 |
caaatatgcctcattttggttttggtccctgacttcacttttgtgatgat |
4042756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 10671707 - 10671764
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||||| || | |||||||| ||||||| |
|
|
| T |
10671707 |
ggtccctgcaaatatgcttcattttggttttggtccctggctccacttttctgatgat |
10671764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 322
Target Start/End: Complemental strand, 25705372 - 25705319
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtga |
322 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | |||||||||||| |
|
|
| T |
25705372 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtga |
25705319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 323
Target Start/End: Complemental strand, 33576068 - 33576015
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
|||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
33576068 |
gtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
33576015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 35686264 - 35686207
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
35686264 |
ggtccctgcaaatatgatgcgttttggttttggtcattggccccacttttgtgatgat |
35686207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 275 - 308
Target Start/End: Complemental strand, 42696180 - 42696147
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgt |
308 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
42696180 |
tgcaaatatgcctcgttttggttttagtccatgt |
42696147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 246
Target Start/End: Original strand, 1138055 - 1138095
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccc |
246 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||| |
|
|
| T |
1138055 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
1138095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 286 - 326
Target Start/End: Original strand, 1696215 - 1696255
Alignment:
| Q |
286 |
ctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||||||||||| || || ||||||||||||||| |
|
|
| T |
1696215 |
ctcgttttggttttggtccctgacctcacttttgtgatgat |
1696255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 2412488 - 2412432
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
2412488 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
2412432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 278 - 326
Target Start/End: Original strand, 3172104 - 3172152
Alignment:
| Q |
278 |
aaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||| ||||||||||||||||||| || ||||| |||| ||||||| |
|
|
| T |
3172104 |
aaatatgtctcgttttggttttggtccctgaccccatttttatgatgat |
3172152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 278 - 326
Target Start/End: Original strand, 3172252 - 3172300
Alignment:
| Q |
278 |
aaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||||||||||||||||||| || ||| | |||| ||||||| |
|
|
| T |
3172252 |
aaatatgcctcgttttggttttggtccctggccctatttttatgatgat |
3172300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 243
Target Start/End: Original strand, 5006605 - 5006657
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||| ||| |||||||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
5006605 |
aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5006657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 200 - 244
Target Start/End: Original strand, 17912456 - 17912500
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||| |||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
17912456 |
atatgattttagtccctgcaaatatgtctcgttttggttttagtc |
17912500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 290 - 326
Target Start/End: Complemental strand, 20939227 - 20939191
Alignment:
| Q |
290 |
ttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| |
|
|
| T |
20939227 |
ttttggttttggtccctgaccccacttttgtgatgat |
20939191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 200 - 244
Target Start/End: Complemental strand, 23990189 - 23990145
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||| |||| |||||||||| | |||||||||||||||| |
|
|
| T |
23990189 |
atatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 29182166 - 29182226
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||||||| | |||||||||||||| |||||| |
|
|
| T |
29182166 |
aaggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtctctgtaa |
29182226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 243
Target Start/End: Complemental strand, 29182440 - 29182392
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||| ||||| ||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 239
Target Start/End: Original strand, 29831812 - 29831860
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttt |
239 |
Q |
| |
|
|||||||| |||| |||||| |||||||||||||| | ||||||||||| |
|
|
| T |
29831812 |
aaggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #210
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 38979889 - 38979945
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatat-gccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctg |
38979945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #211
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 271 - 323
Target Start/End: Original strand, 41451916 - 41451968
Alignment:
| Q |
271 |
tccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
41451916 |
tccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
41451968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 205)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 189 - 251
Target Start/End: Complemental strand, 45228922 - 45228860
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45228922 |
ataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45228860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 1614906 - 1614846
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1614906 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
1614846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 3975547 - 3975607
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3975547 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3975607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 9659691 - 9659631
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9659691 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
9659631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 189 - 251
Target Start/End: Complemental strand, 13770085 - 13770023
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13770085 |
ataaggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgtaa |
13770023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 16853589 - 16853531
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16853531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 25988751 - 25988694
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25988751 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 44402957 - 44403018
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44402957 |
taaggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgtaa |
44403018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 8144659 - 8144603
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8144659 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 12894404 - 12894344
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12894404 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
12894344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 16940760 - 16940820
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
16940760 |
aaggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgtaa |
16940820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 19757746 - 19757806
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19757746 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
19757806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 23399611 - 23399667
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23399611 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 23676453 - 23676397
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23676453 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 184 - 248
Target Start/End: Complemental strand, 25092557 - 25092493
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
25092557 |
tttaaaaaaggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 26878072 - 26878016
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26878072 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 27458397 - 27458457
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
27458397 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
27458457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 28911908 - 28911848
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28911908 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28911848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 29198663 - 29198607
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29198663 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 35837918 - 35837982
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
35837918 |
aaataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
35837982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 41053836 - 41053900
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
41053836 |
aaataaggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaa |
41053900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 184 - 248
Target Start/End: Original strand, 44568317 - 44568381
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
44568317 |
tttaaataaggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 48192489 - 48192433
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48192489 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 5354767 - 5354826
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
5354767 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaa |
5354826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 17999722 - 17999663
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17999722 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
17999663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 184 - 251
Target Start/End: Complemental strand, 30223804 - 30223737
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30223804 |
tttatataaggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgtaa |
30223737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 35104288 - 35104237
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35104288 |
atatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
35104237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 35838338 - 35838279
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
35838338 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35838279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 41054237 - 41054178
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
41054237 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
41054178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 1271590 - 1271541
Alignment:
| Q |
202 |
atggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
1271541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 192 - 245
Target Start/End: Complemental strand, 3975839 - 3975786
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3975839 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 5233806 - 5233863
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5233806 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 6108332 - 6108389
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6108332 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
6108389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 8144293 - 8144350
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
8144293 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 23399978 - 23399921
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
23399978 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 25092158 - 25092215
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
25092158 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 182 - 251
Target Start/End: Complemental strand, 44344800 - 44344731
Alignment:
| Q |
182 |
tttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| | |||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
44344800 |
tttttacaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
44344731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 44509056 - 44508999
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44509056 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 46828941 - 46829002
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
46828941 |
taaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
46829002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 48192255 - 48192312
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48192255 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 1614558 - 1614614
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
1614558 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 2945847 - 2945787
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
2945847 |
aaggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
2945787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 5234206 - 5234146
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
5234206 |
aaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
5234146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 6509206 - 6509266
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
6509206 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgtaa |
6509266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 6509472 - 6509412
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
6509472 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
6509412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 8555801 - 8555741
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
8555801 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
8555741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 25988384 - 25988440
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
25988384 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 37372906 - 37372846
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
37372906 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgtaa |
37372846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 45073643 - 45073583
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45073643 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45073583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 48852442 - 48852502
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
48852442 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccttgtaa |
48852502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 1006835 - 1006890
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1006890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 11767276 - 11767217
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
11767276 |
aggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgtaa |
11767217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 12932784 - 12932725
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
12932784 |
aggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
12932725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 184 - 251
Target Start/End: Original strand, 14543701 - 14543768
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||| | | ||||||||||||||| ||||| |
|
|
| T |
14543701 |
tttaaaaaaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccatgtaa |
14543768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 16941045 - 16940994
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
16941045 |
atatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
16940994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 20388273 - 20388332
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20388273 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
20388332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 27037593 - 27037648
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 28262712 - 28262771
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
28262712 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaa |
28262771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 28911576 - 28911635
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
28911576 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
28911635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 39832905 - 39832964
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
39832905 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
39832964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 44508720 - 44508775
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 46759657 - 46759716
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
46759657 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
46759716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 10358368 - 10358310
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
10358310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 17999465 - 17999523
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgtaa |
17999523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 19561450 - 19561392
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19561392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 186 - 248
Target Start/End: Original strand, 26877671 - 26877733
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||||||||| | |||||||||||||||||||| |
|
|
| T |
26877671 |
taaataaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 35210515 - 35210457
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35210457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 39833236 - 39833178
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| || |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaa |
39833178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 46759942 - 46759884
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
46759884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 6079810 - 6079867
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
6079867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 6589038 - 6589095
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
6589038 |
ggtccctgcaaatatgcctcgttttggttttggtccttggctccacttttgtgatgat |
6589095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 23816659 - 23816728
Alignment:
| Q |
182 |
tttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| || ||||||| |||||||||| ||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
23816659 |
tttttatattaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgtaa |
23816728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 30223459 - 30223516
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
30223459 |
aaggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 35665952 - 35666009
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
35665952 |
ggtccttgcaaatatgtctcgttttggttttggtccctgaccccacttttgtgatgat |
35666009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 183 - 244
Target Start/End: Original strand, 39438731 - 39438792
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
39438731 |
ttttacattaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 39439031 - 39438974
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
39439031 |
aaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 44568692 - 44568635
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
44568692 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 1559707 - 1559647
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
1559707 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgtaa |
1559647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 193 - 245
Target Start/End: Original strand, 6589021 - 6589073
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 6589276 - 6589216
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
6589276 |
aaggttaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccatgtaa |
6589216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 6847117 - 6847061
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtctctgtaa |
6847061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 247
Target Start/End: Complemental strand, 21223750 - 21223694
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| || ||||||||||||||||||| |
|
|
| T |
21223750 |
aaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 23676139 - 23676187
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
23676139 |
atatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 29198302 - 29198358
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
29198302 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 32189388 - 32189332
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
32189332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 35015221 - 35015165
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
35015221 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35015165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 38186364 - 38186424
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
38186364 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctgtaa |
38186424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 244
Target Start/End: Complemental strand, 38486791 - 38486739
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| ||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
38486791 |
aggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 39520396 - 39520456
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||| | ||||||||||||||||||||||| |
|
|
| T |
39520396 |
aaggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgtaa |
39520456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 44958508 - 44958448
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
44958508 |
aaggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
44958448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 244
Target Start/End: Complemental strand, 5355109 - 5355066
Alignment:
| Q |
201 |
tatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5355109 |
tatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 6891977 - 6892028
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
6891977 |
tgcaaatatgcctcattttggttttggtccctgaccccacttttgtgatgat |
6892028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 244
Target Start/End: Original strand, 7431951 - 7432002
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 10358000 - 10358059
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| | || ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10358000 |
aggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
10358059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 11766924 - 11766971
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
11766924 |
atatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 18022705 - 18022646
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18022705 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
18022646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 21554754 - 21554695
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
21554754 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaa |
21554695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 35470281 - 35470222
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| || |||||||| |||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
35470281 |
aggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgtaa |
35470222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 37372444 - 37372495
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
37372444 |
atatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
37372495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 184 - 251
Target Start/End: Complemental strand, 39520739 - 39520672
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||| ||| ||||||||||||||| |||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
39520739 |
tttatataaggttaaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgtaa |
39520672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 39719643 - 39719584
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
39719643 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgtaa |
39719584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 326
Target Start/End: Original strand, 44841363 - 44841489
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgttttggtttt |
299 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| ||||||||||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
44841363 |
atatggttttgatccctgcaaatatgcctcgttttgattttagtccctgtaattttttttgttgtttttggtccctgcaaatatgtctcgttttggtttt |
44841462 |
T |
|
| Q |
300 |
ggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||| | | |||||||||||||||||| |
|
|
| T |
44841463 |
ggttcttaaccccacttttgtgatgat |
44841489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 45073313 - 45073372
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| ||| ||||||||||||| ||||||||| |
|
|
| T |
45073313 |
aggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgtaa |
45073372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 183 - 249
Target Start/End: Original strand, 1559333 - 1559399
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||| ||||||||| |||| ||||| ||||||||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
1559333 |
ttttaattaaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgt |
1559399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 1974009 - 1974067
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
1974067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 13769774 - 13769832
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
13769832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 243
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 25547490 - 25547432
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
25547432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 31732101 - 31732159
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgtaa |
31732159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 192 - 250
Target Start/End: Original strand, 35665876 - 35665934
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
35665876 |
aggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgta |
35665934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 46829312 - 46829254
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgtaa |
46829254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 9659432 - 9659489
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
9659432 |
ggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgat |
9659489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 14739006 - 14738949
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
14739006 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
14738949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 16940839 - 16940896
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
16940839 |
ggtccttgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
16940896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 27458476 - 27458533
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
27458476 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
27458533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 30352558 - 30352615
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
30352558 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 35104076 - 35104133
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
35104076 |
aaggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 37527421 - 37527364
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgtaa |
37527364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 41054099 - 41054042
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
41054099 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
41054042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 41054163 - 41054118
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
41054118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 251
Target Start/End: Complemental strand, 48854080 - 48854012
Alignment:
| Q |
182 |
tttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||| ||||| ||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48854080 |
tttttaaa-aaggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgtaa |
48854012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 278 - 326
Target Start/End: Complemental strand, 2945759 - 2945711
Alignment:
| Q |
278 |
aaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||| ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
2945759 |
aaatatgtctcgttttggttttggtccctggccccacttttgtgatgat |
2945711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 5308688 - 5308629
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
5308688 |
aaggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctgtaa |
5308629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 9659354 - 9659410
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
9659354 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 17854151 - 17854207
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaa |
17854207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 34878127 - 34878067
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| | ||||||||||||| || |||||| |
|
|
| T |
34878127 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttaatctctgtaa |
34878067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 45021494 - 45021550
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgtttt-ggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 45228614 - 45228670
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||| ||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
45228614 |
aggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 46648717 - 46648657
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
46648717 |
aaggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttaatccttgtaa |
46648657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 3807863 - 3807922
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||| |||||||| |||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
3807863 |
aggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgtaa |
3807922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 6892261 - 6892202
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||| | ||||||| |||||||||||||| |
|
|
| T |
6892261 |
aggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgtaa |
6892202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 19783814 - 19783873
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||| ||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
19783814 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
19783873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 30352904 - 30352849
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30352849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 34877781 - 34877828
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
34877781 |
atatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 243
Target Start/End: Complemental strand, 45021857 - 45021806
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| | ||||||||||||| |
|
|
| T |
45021857 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 245
Target Start/End: Original strand, 46304079 - 46304138
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||| |||||||| ||||| |||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
46304079 |
taaagaaggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 46829227 - 46829176
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||||| |||||||||||||||| || | |||||||||||||||| |
|
|
| T |
46829227 |
tgcaaatatgccttgttttggttttggtccctgactccacttttgtgatgat |
46829176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 5308323 - 5308381
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||| |||||||||| | |||||| |||||||||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaa |
5308381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 250
Target Start/End: Original strand, 6954865 - 6954915
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
6954865 |
atatggttttggtccctgcaaatatatctcgttttggttttagtctctgta |
6954915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 21223405 - 21223463
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| |||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgtaa |
21223463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 21554393 - 21554451
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| ||||||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtccttgtaa |
21554451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 247
Target Start/End: Complemental strand, 24717532 - 24717478
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| ||||||||||||||||| | |||||| | ||||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 28528905 - 28528963
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||||| |||| ||||||| | ||||| ||||||||||||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgtaa |
28528963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 35469880 - 35469938
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgtaa |
35469938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 39719353 - 39719411
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||| |||||||||| | |||||||||||||| |||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgtaa |
39719411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 247
Target Start/End: Complemental strand, 44403249 - 44403195
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| |||||||||| |||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct |
44403195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 46304384 - 46304326
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
46304326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 243
Target Start/End: Complemental strand, 48359075 - 48359025
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 3975762 - 3975705
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||| ||||| |
|
|
| T |
3975762 |
ggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtaatgat |
3975705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 5355041 - 5354984
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
5355041 |
ggtccctgcaaatatgcttcattttggttttggtccctggctccacttttgtgatgat |
5354984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 22539929 - 22539986
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||| ||||||||||| ||||| |||||||||| | ||||||||||||| ||||| |
|
|
| T |
22539929 |
aggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctgt |
22539986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 30709322 - 30709383
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||| ||||| |||| |||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30709322 |
taaggttaaaatatgattttagtccctacaaatatgcctcgttttggttttagtccttgtaa |
30709383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 239
Target Start/End: Complemental strand, 31310682 - 31310633
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttt |
239 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
31310682 |
taaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 34877859 - 34877907
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||| |||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
34877859 |
caaatatacctcgttttggttttggtcc-tgaccccacttttgtgatgat |
34877907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 35104095 - 35104152
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||| || | |||||||||||||||| |
|
|
| T |
35104095 |
ggtccctgcaaatatgtctcgttttggttttagtccctgactccacttttgtgatgat |
35104152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 35210181 - 35210238
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||| ||||| ||||| |||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
35210181 |
aggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgt |
35210238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 48852521 - 48852578
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||||||| || | |||||||||||||||| |
|
|
| T |
48852521 |
ggtccctgcaaatatgcctcattttgattttggtccctggctccacttttgtgatgat |
48852578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 489074 - 489014
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| |||| ||| ||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
489074 |
aaggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgtaa |
489014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 251
Target Start/End: Original strand, 12894059 - 12894099
Alignment:
| Q |
211 |
gtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
12894059 |
gtccctgcaaatatgcctcgttttggttttaatccctgtaa |
12894099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 251
Target Start/End: Complemental strand, 19758041 - 19758001
Alignment:
| Q |
211 |
gtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
19758041 |
gtccctgcaaatatgcctcattttggttttagtccctgtaa |
19758001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 244
Target Start/End: Complemental strand, 30709645 - 30709593
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
30709645 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 31503418 - 31503478
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||||| ||||| ||||||| | | ||||||||||||||||||||| |
|
|
| T |
31503418 |
aaggttaaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgtaa |
31503478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 31732453 - 31732393
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||||| ||||||| |||||| || ||||| |
|
|
| T |
31732453 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagcccttgtaa |
31732393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 270 - 326
Target Start/End: Complemental strand, 35470202 - 35470146
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| || | | |||||||||||||| |
|
|
| T |
35470202 |
gtccctgcaaatatgcctcattttggttttggtccctggctctacttttgtgatgat |
35470146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 19465981 - 19465923
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| | ||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
19465981 |
aggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctgtaa |
19465923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 200 - 243
Target Start/End: Original strand, 25547260 - 25547303
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
25547260 |
atatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 269 - 304
Target Start/End: Complemental strand, 30223778 - 30223743
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtcc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30223778 |
ggtccatgcaaatatgcctcgttttggttttagtcc |
30223743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 31310364 - 31310423
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||| |||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
31310364 |
aggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgtaa |
31310423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 31503776 - 31503725
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||||| |||||||| |||||| |
|
|
| T |
31503776 |
atatggttttagtccctgcaaatatgtctcgttttgattttagtctctgtaa |
31503725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 190 - 244
Target Start/End: Complemental strand, 38186764 - 38186709
Alignment:
| Q |
190 |
taaggctaagatatggtttt-ggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||||| ||||| |||| |||||||||||||||| | |||||||||||||||| |
|
|
| T |
38186764 |
taaggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 38486710 - 38486659
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||||||||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
38486710 |
tgcaaatatgtctcgttttgattttggtctctgtccacacttttgtgatgat |
38486659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 194 - 245
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||| |||||||||| || |||||||||||| | ||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 244
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
3808068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 3975766 - 3975724
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
3975766 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3975724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 5233881 - 5233923
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
5233881 |
ttttggtccctgcaaatatgtcccattttggttttggtccctg |
5233923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 9659428 - 9659470
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
9659428 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9659470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 23399689 - 23399743
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
23399689 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
23399743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 23676209 - 23676263
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
23676209 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
23676263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 24953828 - 24953878
Alignment:
| Q |
201 |
tatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggttttagtccatgtaa |
24953878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 25988672 - 25988618
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
25988672 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
25988618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 26877755 - 26877809
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
26877755 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
26877809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 27037856 - 27037802
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
27037856 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
27037802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 27458472 - 27458514
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
27458472 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
27458514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 41054103 - 41054061
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
41054103 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
41054061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 44568403 - 44568457
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
44568403 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
44568457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 3808102 - 3808045
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||| ||| || || ||||||||||||||| |
|
|
| T |
3808102 |
ggtccctgcaaatatgtctcgttttggttttagtctctgacctcacttttgtgatgat |
3808045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 6887245 - 6887294
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||| |||||||||||||||||| || ||| |||||||||||||| |
|
|
| T |
6887245 |
caaatatgtttcgttttggttttggtccctgacccaacttttgtgatgat |
6887294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 11767002 - 11767051
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||| ||||||||||||||| | | |||||||||||||||| |
|
|
| T |
11767002 |
caaatatgcctcattttggttttggtccctagctccacttttgtgatgat |
11767051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 194 - 243
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
||||| |||||||||| ||||| ||||||||| | ||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 18311581 - 18311638
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| ||| || |||||||||| ||||||||||||| || |||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggttttattctctgtaa |
18311638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 251
Target Start/End: Complemental strand, 27458698 - 27458661
Alignment:
| Q |
214 |
cctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
27458698 |
cctgcaaatatgcctcgttttagttttagtccctgtaa |
27458661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 35212066 - 35212123
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
35212066 |
aaggctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctg |
35212123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 35838001 - 35838058
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| || ||||||| ||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
35838001 |
ggtccctgtaaatatgtctcattttggttttggtccctgactccacttttgtgatgat |
35838058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 37527345 - 37527288
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||| ||||| |||||||| || |||||||||||||||||| |
|
|
| T |
37527345 |
ggtccctgcaaatatgtctcattttgattttggtctttggccccacttttgtgatgat |
37527288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 39438952 - 39438895
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| || ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
39438952 |
ggtccctgcaaatatgtcttattttggttttggtccctgactccacttttgtgatgat |
39438895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 194 - 243
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
||||| |||||||||| || || ||||||||||| ||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 19005865 - 19005825
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccc |
246 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||| |
|
|
| T |
19005865 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
19005825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 28263069 - 28263013
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
28263069 |
ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgtaa |
28263013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 200 - 240
Target Start/End: Complemental strand, 28529202 - 28529162
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
|||||||||||||| ||||||||||| | |||||||||||| |
|
|
| T |
28529202 |
atatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
|||||| ||||| |||| |||||||||||||||| ||||||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 275 - 323
Target Start/End: Complemental strand, 36684738 - 36684690
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
|||||||||| |||||||||||||||||| || |||||||||||||| |
|
|
| T |
36684738 |
tgcaaatatgtctcgttttggttttggtctctgggcccacttttgtgat |
36684690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 37952671 - 37952727
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctgtaa |
37952727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 249
Target Start/End: Original strand, 41364884 - 41364940
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||| |||||||||| || || |||||||| | ||||||||||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgt |
41364940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 43058752 - 43058808
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||| ||||| ||||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctgtaa |
43058808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 6e-22; HSPs: 249)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 186 - 251
Target Start/End: Complemental strand, 12360975 - 12360910
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
12360975 |
taaataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
12360910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 186 - 251
Target Start/End: Complemental strand, 24507850 - 24507785
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24507850 |
taaaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24507785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 29072491 - 29072555
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29072491 |
aaataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29072555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 33045692 - 33045632
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33045692 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
33045632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 185 - 251
Target Start/End: Original strand, 33234538 - 33234604
Alignment:
| Q |
185 |
ttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
33234538 |
ttaaaaaaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
33234604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 38151212 - 38151154
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38151154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 186 - 251
Target Start/End: Original strand, 19720705 - 19720770
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
19720705 |
taaaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19720770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 38164297 - 38164240
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38164297 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 44157696 - 44157753
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44157753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 47819598 - 47819541
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47819598 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 3247196 - 3247256
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
3247196 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
3247256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 8140428 - 8140492
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
8140428 |
aaattaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
8140492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 12361005 - 12361069
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
12361005 |
aaataaggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaa |
12361069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 188 - 248
Target Start/End: Complemental strand, 32729054 - 32728994
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32729054 |
aataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
32728994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 45368488 - 45368548
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45368488 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45368548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 47819231 - 47819287
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47819231 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 13770488 - 13770547
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13770488 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13770547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 18302388 - 18302329
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
18302329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 22919683 - 22919742
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22919683 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
22919742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 24653802 - 24653857
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 26324584 - 26324643
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26324584 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
26324643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 39747836 - 39747777
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
39747836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
39747777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 191 - 249
Target Start/End: Original strand, 1810925 - 1810983
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1810925 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
1810983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 185 - 251
Target Start/End: Original strand, 3679618 - 3679684
Alignment:
| Q |
185 |
ttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||| |||||||||| |||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
3679618 |
ttaaaaaaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
3679684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 8140802 - 8140744
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
8140802 |
taaggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 10631164 - 10631222
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
10631222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 16060885 - 16060827
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
16060827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 33000305 - 33000363
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
33000363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 185 - 247
Target Start/End: Original strand, 33379880 - 33379942
Alignment:
| Q |
185 |
ttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||| |||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33379880 |
ttaaaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
33379942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 35308111 - 35308053
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
35308053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 3753214 - 3753271
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3753271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 10631530 - 10631473
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
10631530 |
aaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 15526364 - 15526307
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
15526364 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 19623023 - 19622962
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19623023 |
aaataaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
19622962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 26061954 - 26062011
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26061954 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26062011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 30322927 - 30322984
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
30322927 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 33000671 - 33000614
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
33000671 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 38163929 - 38163986
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38163929 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 186 - 247
Target Start/End: Original strand, 44641071 - 44641132
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| ||||| |||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44641071 |
taaataaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 188 - 248
Target Start/End: Original strand, 990083 - 990143
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||| |||||||||| |||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
990083 |
aataaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
990143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 990380 - 990324
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
990380 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
990324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 3247555 - 3247507
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3247555 |
atatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 4789310 - 4789366
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4789366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 6567498 - 6567438
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
6567498 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
6567438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 187 - 247
Target Start/End: Complemental strand, 10887604 - 10887544
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
10887604 |
aaattaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 11822002 - 11822062
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
11822002 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
11822062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 15516581 - 15516637
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15516581 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 16026939 - 16026883
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
16026939 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 183 - 251
Target Start/End: Original strand, 18079388 - 18079456
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
18079388 |
ttttaaaaaaggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgtaa |
18079456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 18473271 - 18473327
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18473271 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18473327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 247
Target Start/End: Complemental strand, 18473597 - 18473541
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18473597 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 26442901 - 26442841
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26442901 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaa |
26442841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 30323294 - 30323238
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30323294 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 35056895 - 35056839
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35056895 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 35307713 - 35307773
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
35307713 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
35307773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 41358368 - 41358424
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 45380271 - 45380327
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
45380271 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 7001897 - 7001842
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7001842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 14007488 - 14007547
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
14007547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 24507479 - 24507534
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 24977778 - 24977833
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 32454295 - 32454236
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
32454295 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaa |
32454236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 33045354 - 33045413
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33045354 |
aggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgtaa |
33045413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 35056530 - 35056585
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 38136981 - 38136926
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 40718110 - 40718165
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 45380636 - 45380581
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 45638580 - 45638635
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 50429210 - 50429151
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50429210 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
50429151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 50799129 - 50799188
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
50799129 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
50799188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 191 - 249
Target Start/End: Complemental strand, 3753574 - 3753516
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
3753574 |
aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
3753516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 12322970 - 12322912
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgtaa |
12322912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 29072862 - 29072804
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgtaa |
29072804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 31258336 - 31258394
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
31258336 |
taaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
31258394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 33234912 - 33234854
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
33234854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 41738796 - 41738854
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| | |||| |||||||||||||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgtaa |
41738854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 44641432 - 44641374
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44641374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 48956066 - 48956008
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
48956008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 52254479 - 52254421
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
52254421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 7350659 - 7350602
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
7350659 |
ggtccctgcaaatatgcctcgttttggttttggtctctggccccacttttgtgatgat |
7350602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 13260327 - 13260266
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
13260327 |
aaattaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 15058419 - 15058476
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccttgtaa |
15058476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 15466209 - 15466266
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
15466209 |
ggtccctgcaaatatgtctcgttttagttttgatccatgtccccacttttgtgatgat |
15466266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 21391095 - 21391152
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
21391095 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
21391152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 24654169 - 24654112
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||| ||||| |
|
|
| T |
24654169 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
24654112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 206 - 326
Target Start/End: Complemental strand, 25658288 - 25658168
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgttttggttttggtcca |
305 |
Q |
| |
|
||||| |||||||||||||||| ||||||| ||||||||||||||| ||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
25658288 |
ttttgatccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaattgttgttaatggtccctgcaaatatgcctcattttggttttggtcca |
25658189 |
T |
|
| Q |
306 |
tgtccccacttttgtgatgat |
326 |
Q |
| |
|
|| | |||||||||||||||| |
|
|
| T |
25658188 |
tggctccacttttgtgatgat |
25658168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 326
Target Start/End: Original strand, 32420099 - 32420231
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgtttt |
293 |
Q |
| |
|
||||| ||||||||||||||| |||||||||| | |||||||||||||||||||| || ||||| | ||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgcaattttttttgttgtttttggtccttacaaatatgcctcgtttt |
32420198 |
T |
|
| Q |
294 |
ggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||| || || |||||||||||||||||| |
|
|
| T |
32420199 |
ggttttggaccctgaccccacttttgtgatgat |
32420231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 35005442 - 35005499
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
35005442 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 192 - 245
Target Start/End: Complemental strand, 35005745 - 35005692
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35005745 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 38150846 - 38150903
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
38150846 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 45290455 - 45290512
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
45290455 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
45290512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 49073976 - 49073919
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
49073976 |
ggtccttgcaaatatgcctcattttggttttggtccctgaccccacttttgtgatgat |
49073919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 5058994 - 5058934
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||||||||||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
5058994 |
aaggttaaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgtaa |
5058934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 7867359 - 7867299
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
7867359 |
aaggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgtaa |
7867299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 10887232 - 10887288
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10887232 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 15211509 - 15211569
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| | |||||||||||||||| |||||| |
|
|
| T |
15211509 |
aaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgtaa |
15211569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 16060594 - 16060653
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
16060594 |
aaggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtcactgtaa |
16060653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 17129691 - 17129747
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||||||| | |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgtaa |
17129747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 19721067 - 19721019
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19721067 |
atatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 26207280 - 26207336
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||||||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
26207336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 247
Target Start/End: Complemental strand, 29688430 - 29688374
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29688430 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct |
29688374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 188 - 248
Target Start/End: Complemental strand, 31061156 - 31061096
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||| | |||||||||||||||||||| |
|
|
| T |
31061156 |
aataaggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 32626527 - 32626587
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
32626527 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
32626587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 34002942 - 34002882
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
34002942 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgtaa |
34002882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 37624764 - 37624820
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
37624764 |
gtccctgcaaatatgcctcgttttggttttggtccataaccctacttttgtgatgat |
37624820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 247
Target Start/End: Complemental strand, 44158044 - 44157988
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44158044 |
aaggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct |
44157988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 45290821 - 45290765
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
45290821 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
45290765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 46183686 - 46183742
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccccgtaa |
46183742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 48609234 - 48609294
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
48609234 |
aaggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgtaa |
48609294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 52254181 - 52254241
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
52254181 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaa |
52254241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 2939936 - 2939987
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2939936 |
atatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaa |
2939987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 11822366 - 11822307
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
11822366 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgtaa |
11822307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 12360602 - 12360661
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| | |||| ||||||| |||||||| |
|
|
| T |
12360602 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctgtaa |
12360661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 13259987 - 13260046
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13259987 |
aggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgtaa |
13260046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 18900126 - 18900075
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
18900126 |
atatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaa |
18900075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 247
Target Start/End: Original strand, 19622654 - 19622709
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
19622654 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
19622709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 24649350 - 24649405
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg |
24649405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 24649653 - 24649602
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24649653 |
atatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
24649602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 31060787 - 31060842
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 37545628 - 37545683
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| |||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 42482978 - 42483037
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | | |||||||||||||| |||||| |
|
|
| T |
42482978 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgtaa |
42483037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 48609595 - 48609536
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
48609595 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcactgtaa |
48609536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 191 - 249
Target Start/End: Original strand, 17984331 - 17984389
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
17984331 |
aaggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtctctgt |
17984389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 25658014 - 25658072
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgtaa |
25658072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 26191359 - 26191417
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
26191417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 26191734 - 26191676
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
26191676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 26442563 - 26442621
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccatgtaa |
26442621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 187 - 245
Target Start/End: Original strand, 37624740 - 37624798
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||||||||| |||||||||||| |||| |
|
|
| T |
37624740 |
aaataaggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 247
Target Start/End: Complemental strand, 39025381 - 39025328
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 41881090 - 41881148
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||| |||||| |||||||| | |||||||||||||||||||| |
|
|
| T |
41881090 |
taaggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg |
41881148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 4323829 - 4323886
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgtaa |
4323886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 10887310 - 10887367
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
10887310 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
10887367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 15211779 - 15211722
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| || |||||||||||| ||||| |
|
|
| T |
15211779 |
ggtccttgcaaatatgtctcgttttggttttggtccctggccccacttttgttatgat |
15211722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 17130007 - 17129950
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
17130007 |
ggtccttgcaaatatgtctcgttttggttttggtccctgactccacttttgtgatgat |
17129950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 18079476 - 18079533
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| || |||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
18079476 |
ggtccctgtaaatatgcctcgttttggttttggtctctggccccacttttgtgatgat |
18079533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 18208768 - 18208817
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
18208768 |
caaatatgcctcgttttggttttggtccatggcatcacttttgtgatgat |
18208817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 18899836 - 18899897
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||| |||||||||| ||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
18899836 |
taaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
18899897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 193 - 250
Target Start/End: Original strand, 20948755 - 20948812
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||| | ||||| |||||||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgta |
20948812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 26324870 - 26324813
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
26324870 |
ggtccctgcaaatatgtctcgttttggttttcgtccctgaccccacttttgtgatgat |
26324813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 27521577 - 27521634
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
27521634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 33045433 - 33045490
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||||||| | |||||||||||||||| |
|
|
| T |
33045433 |
ggtccctgcaaatatgcatcattttggttttggtccatggctccacttttgtgatgat |
33045490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 39025126 - 39025183
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
39025126 |
ggtccctgcaaatatgtctcgttttgattttcgtccatggccccacttttgtgatgat |
39025183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 39303675 - 39303732
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| |||||||||| |||| | ||||||||||||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgtaa |
39303732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 44157965 - 44157908
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
44157965 |
ggtccctgcaaatatgcctcattttggttttggtccttggctccacttttgtgatgat |
44157908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 241
Target Start/End: Complemental strand, 45638895 - 45638846
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
45638895 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 193 - 249
Target Start/End: Complemental strand, 3679986 - 3679930
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt |
3679930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 247
Target Start/End: Original strand, 16026571 - 16026627
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
16026571 |
aaggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccct |
16026627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 24978124 - 24978064
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| |||||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
24978124 |
aaggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgtaa |
24978064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 183 - 251
Target Start/End: Complemental strand, 28507467 - 28507400
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||||||| | | |||| |||||||||||||||| |
|
|
| T |
28507467 |
ttttaaata-ggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgtaa |
28507400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 30962415 - 30962471
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||| |||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
30962415 |
aggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
30962471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 31258695 - 31258647
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
31258695 |
atatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg |
31258647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 41358664 - 41358608
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
41358664 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
41358608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 45368847 - 45368791
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||| |||| ||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
45368791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 48730615 - 48730559
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtccttgtaa |
48730559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 244
Target Start/End: Original strand, 48955713 - 48955765
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
48955713 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 247
Target Start/End: Original strand, 49073689 - 49073745
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| | ||||||||||||| ||||| |
|
|
| T |
49073689 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 188 - 251
Target Start/End: Complemental strand, 4360631 - 4360568
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| | |||| |||||||| |||||||| |
|
|
| T |
4360631 |
aataaggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctgtaa |
4360568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 4565337 - 4565278
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
4565337 |
aggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgtaa |
4565278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 7350729 - 7350678
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||| |||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
7350729 |
atatggttttggtcactgcaaatatacctcgttttggttttagtccttgtaa |
7350678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 7819104 - 7819045
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| || ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
7819104 |
aggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgtaa |
7819045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 7867128 - 7867187
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||| | |||||| |||||||||||||||| |
|
|
| T |
7867128 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaa |
7867187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 12360686 - 12360737
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| | ||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
12360686 |
tgcaaatatgtcccgttttggttttggtccctgaccccacttttgtgatgat |
12360737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 15211858 - 15211803
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||||||||| | |||||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg |
15211803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 15335288 - 15335237
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||| ||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
15335288 |
atatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
15335237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 244
Target Start/End: Complemental strand, 17984701 - 17984650
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 19198866 - 19198815
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||| ||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
19198866 |
tgcaaatatgcttcgttttggttttggtctctgaccccacttttgtgatgat |
19198815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 21383103 - 21383162
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||| |||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
21383103 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaa |
21383162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 22919978 - 22919919
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
22919978 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtccttgtaa |
22919919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 26324948 - 26324889
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||| |||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
26324948 |
aggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctgtaa |
26324889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 34808204 - 34808255
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
34808204 |
atatggttttagtcccttcaaatatgtctcgttttggttttagtccctgtaa |
34808255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 40718474 - 40718419
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg |
40718419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 46868577 - 46868522
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
46868522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 276 - 326
Target Start/End: Original strand, 4789392 - 4789442
Alignment:
| Q |
276 |
gcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||| ||||||||| ||||||||| || |||||||||||||||||| |
|
|
| T |
4789392 |
gcaaatatgtctcgttttgattttggtccctgaccccacttttgtgatgat |
4789442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 276 - 326
Target Start/End: Complemental strand, 8364892 - 8364842
Alignment:
| Q |
276 |
gcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||| |||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
8364892 |
gcaaatatgtctcgttttggttttcgtccctgaccccacttttgtgatgat |
8364842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 195 - 241
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 39747471 - 39747528
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| | | |||||||||||||||||||| |
|
|
| T |
39747471 |
taaggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 240
Target Start/End: Complemental strand, 42483274 - 42483224
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42483274 |
taaggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 250
Target Start/End: Complemental strand, 49923819 - 49923761
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
||||||| ||||| |||||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
49923819 |
aggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgta |
49923761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 292868 - 292913
Alignment:
| Q |
202 |
atggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 243
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
||||| |||| ||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 16060672 - 16060729
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||||||| || | |||||||||||||||| |
|
|
| T |
16060672 |
ggtccctgcaaatatgcctcattttgattttggtccctggctccacttttgtgatgat |
16060729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 187 - 244
Target Start/End: Original strand, 16083041 - 16083098
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||||| |||||||||| ||||| ||||||||| | |||||| ||||||||| |
|
|
| T |
16083041 |
aaataaggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 18927854 - 18927911
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
18927854 |
ggtccctgcaaatatgtttcgttttggttttggtctctgaccccacttttgtgatgat |
18927911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 19198948 - 19198891
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgtaa |
19198891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 193 - 242
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttag |
242 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | |||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 24510019 - 24510076
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| | |||||||||| |||||| || |||||||||||||||||| |
|
|
| T |
24510019 |
ggtccctgcaaatatgacgcgttttggttgtggtccctgaccccacttttgtgatgat |
24510076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 28507192 - 28507249
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
28507192 |
ggtccctgcaaatatgcctcgttttggttttggtctctgatcccaattttgtgatgat |
28507249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 34002652 - 34002705
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtga |
322 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||| || |||||||||||||| |
|
|
| T |
34002652 |
ggtccctgcaaatatgtctcgttttggttttggtctataaccccacttttgtga |
34002705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 41739121 - 41739065
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41739121 |
aggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgtaa |
41739065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 42483254 - 42483197
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||| | || |||||||||||||||||| |
|
|
| T |
42483254 |
ggtccctgcaaatatgctttgttttggttttggttcttgaccccacttttgtgatgat |
42483197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 203 - 251
Target Start/End: Complemental strand, 4789634 - 4789586
Alignment:
| Q |
203 |
tggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
4789634 |
tggttttggtccctgcaaatatgcatcattttggttttggtccctgtaa |
4789586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 8364614 - 8364674
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| ||||||||||| |||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
8364614 |
aaggttaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgtaa |
8364674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 8364917 - 8364861
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||| ||||||||||| ||||||||| | |||||||||||| ||||||| |
|
|
| T |
8364917 |
aggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 15058768 - 15058716
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||||| |||| |||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
15058768 |
aaggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 235
Target Start/End: Complemental strand, 18079662 - 18079618
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttg |
235 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
18079662 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 251
Target Start/End: Original strand, 18302071 - 18302111
Alignment:
| Q |
211 |
gtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
18302071 |
gtccctgcaaatatgtctcgttttggttttagtccctgtaa |
18302111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 244
Target Start/End: Original strand, 22674202 - 22674254
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| ||||||||| ||||| |||||||||| | |||||||||||||||| |
|
|
| T |
22674202 |
aggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 245
Target Start/End: Original strand, 39025105 - 39025161
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||| | ||||||| |||| |||| |
|
|
| T |
39025105 |
ataaggttaaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 190 - 245
Target Start/End: Original strand, 7350420 - 7350475
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||| ||| |||||||||| ||||||||||||||| | | ||||||||||||||| |
|
|
| T |
7350420 |
taaggttaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 12322688 - 12322739
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||| || |||||||||| ||||||| |
|
|
| T |
12322688 |
tgcaaatatgcctcgttttgattttggtctctgaccccacttttatgatgat |
12322739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 16083392 - 16083341
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||||| |||||||| |||||| |
|
|
| T |
16083392 |
atatggttttagtccctgcaaatatacctcgttttgattttagtctctgtaa |
16083341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 26699607 - 26699549
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||| |||||| ||||||||| |||||| |
|
|
| T |
26699607 |
aggctaaaatatggttttggtcc-tgcaaatatgcttcgtttttgttttagtctctgtaa |
26699549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 271 - 326
Target Start/End: Original strand, 33234626 - 33234681
Alignment:
| Q |
271 |
tccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||| |||||||||| ||||||||| ||||||||| || | |||||||||||||||| |
|
|
| T |
33234626 |
tccctgcaaatatgtctcgttttgattttggtccctggctccacttttgtgatgat |
33234681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 235
Target Start/End: Original strand, 36912852 - 36912895
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttg |
235 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||| |
|
|
| T |
36912852 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 3247485 - 3247431
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
3247485 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
3247431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 240
Target Start/End: Complemental strand, 7350663 - 7350629
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
7350663 |
ttttggtccctgcaaatatgcctcgttttggtttt |
7350629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 10887306 - 10887348
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
10887306 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
10887348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 12322604 - 12322662
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtccttgtaa |
12322662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 12360676 - 12360718
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
12360676 |
ttttgatccctgcaaatatgtcccgttttggttttggtccctg |
12360718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 15466132 - 15466190
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||||||| | | ||||||| | ||||||||||||||||||||| |
|
|
| T |
15466132 |
ggctaaaatatggttttggtccttacggatatgcctcattttggttttagtccctgtaa |
15466190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 16026861 - 16026807
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
16026861 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
16026807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 19720997 - 19720943
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
19720997 |
ggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgat |
19720943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 24507556 - 24507610
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
24507556 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
24507610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 243
Target Start/End: Complemental strand, 24510308 - 24510258
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 26324874 - 26324832
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||| |
|
|
| T |
26324874 |
ttttggtccctgcaaatatgtctcgttttggttttcgtccctg |
26324832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 304
Target Start/End: Complemental strand, 26442881 - 26442847
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtcc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
26442881 |
gtccatgcaaatatgcctcgttttggttttagtcc |
26442847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 224
Target Start/End: Original strand, 27262901 - 27262939
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatat |
224 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
27262901 |
taaataaggctaaaatatgtttttggtccctgcaaatat |
27262939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 240
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
28507188 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28507222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 30323216 - 30323162
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
30323216 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
30323162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 248
Target Start/End: Complemental strand, 30968148 - 30968086
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| |||||||| ||||| ||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
30968148 |
taaaaaaggctaaaatatgacattggtccctgcaaatatgctcaattttggttttagtccctg |
30968086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 31061074 - 31061020
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
31061074 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
31061020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 33000592 - 33000538
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
33000592 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
33000538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 240
Target Start/End: Original strand, 34002625 - 34002682
Alignment:
| Q |
182 |
tttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
|||||||| |||||||| |||| |||||||||||||||||||| | |||||||||||| |
|
|
| T |
34002625 |
tttttaaa-aaggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 35056817 - 35056763
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
35056817 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
35056763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 270 - 304
Target Start/End: Original strand, 37545646 - 37545680
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtcc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
37545646 |
gtccatgcaaatatgcctcgttttggttttagtcc |
37545680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 38136904 - 38136850
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
38136904 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
38136850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 38150925 - 38150979
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
38150925 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
38150979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 40718397 - 40718343
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
40718397 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
40718343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 45380349 - 45380403
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
45380349 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
45380403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 45638657 - 45638711
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
45638657 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
45638711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 46183757 - 46183799
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
46183757 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
46183799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 18928141 - 18928084
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| | | |||| ||||||||||| |||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtcccggtaa |
18928084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 24977856 - 24977913
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| | | |||||||||||||||| |
|
|
| T |
24977856 |
ggtccctgcaaatatgtctcattttggttttggtccctagctccacttttgtgatgat |
24977913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 299
Target Start/End: Complemental strand, 26324929 - 26324900
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggtttt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26324929 |
gtccatgcaaatatgcctcgttttggtttt |
26324900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 245
Target Start/End: Original strand, 32035443 - 32035488
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||||||| || ||||||||||| | ||||||||||||||||| |
|
|
| T |
32035443 |
atatggttttgatctctgcaaatatgtctcgttttggttttagtcc |
32035488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 326
Target Start/End: Complemental strand, 32035710 - 32035661
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||| |||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
32035710 |
caaatatgtctcgcgttggttttggtccttggccccacttttgtgatgat |
32035661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 225
Target Start/End: Complemental strand, 32035789 - 32035756
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatg |
225 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
32035789 |
aggctaaaatatggttttggtccctgcaaatatg |
32035756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 245
Target Start/End: Original strand, 33067347 - 33067400
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||| | |||||||||||| |||| |
|
|
| T |
33067347 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 34382948 - 34383004
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| |||||||||||||| || || ||||||||||||| |||||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagtctctgtaa |
34383004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 39747550 - 39747607
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| | | |||||||||||||||| |
|
|
| T |
39747550 |
ggtccctgcaaatatgccttattttggttttggtcccgggctccacttttgtgatgat |
39747607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 275 - 323
Target Start/End: Complemental strand, 10631445 - 10631397
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
10631445 |
tgcaaatatgtctcattttggttttggtccctgactccacttttgtgat |
10631397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 224
Target Start/End: Complemental strand, 17977623 - 17977587
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatat |
224 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
17977623 |
aataaggcttaaatatggttttggtccctgcaaatat |
17977587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 29579322 - 29579378
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||| | |||| ||||||||||||||| |
|
|
| T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctgtaa |
29579378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 31404723 - 31404667
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||||||||| |||| ||| | |||| | ||||||||||||| |
|
|
| T |
31404723 |
aggctaaaatatggttttggtccctacaaacatgtctcgttgttgttttagtccctg |
31404667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 35005462 - 35005518
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||||||||||||| |||| |||| || ||| | |||||||||||| |
|
|
| T |
35005462 |
gtccctgcaaatatgcctcgttttgattttagtccctgaccctagttttgtgatgat |
35005518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 224
Target Start/End: Original strand, 37395628 - 37395664
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatat |
224 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
37395628 |
aataaggctaaaatatgtttttggtccctgcaaatat |
37395664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #248
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 251
Target Start/End: Original strand, 37646760 - 37646800
Alignment:
| Q |
211 |
gtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
37646760 |
gtccctgcaaatatgcttcgttttgattttagtccctgtaa |
37646800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #249
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 46868224 - 46868284
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| |||| |||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
46868224 |
aaggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtctctgtaa |
46868284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 214)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 11976371 - 11976431
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11976371 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11976431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 188 - 248
Target Start/End: Original strand, 34963295 - 34963355
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34963295 |
aataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 7326421 - 7326363
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
7326363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 189 - 251
Target Start/End: Complemental strand, 10540786 - 10540724
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10540786 |
ataaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaa |
10540724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 28346391 - 28346449
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28346391 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 40066820 - 40066762
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgtaa |
40066762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 4474047 - 4473986
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4474047 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaa |
4473986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 7420593 - 7420532
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7420593 |
taaggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaa |
7420532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 187 - 248
Target Start/End: Original strand, 22917558 - 22917619
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22917558 |
aaataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22917619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 37536084 - 37536141
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37536084 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 4710221 - 4710165
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4710221 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 183 - 251
Target Start/End: Original strand, 8298577 - 8298645
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| || |||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
8298577 |
ttttaattatggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
8298645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 8298977 - 8298917
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
8298977 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
8298917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 10872913 - 10872973
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10872913 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaa |
10872973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 11019858 - 11019802
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11019858 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 194 - 326
Target Start/End: Complemental strand, 13779531 - 13779401
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgtttt |
293 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||| |||||||||||||| |||||||| ||||| |||||||||| |||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctgtaatttttttttgttttt--ggtccctgcaaatatgtctcgtttt |
13779434 |
T |
|
| Q |
294 |
ggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
13779433 |
ggttttggtccatgaccccacttttgtgatgat |
13779401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 20277690 - 20277750
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
20277690 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaa |
20277750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 20984144 - 20984204
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
20984144 |
aaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaa |
20984204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 21064317 - 21064377
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
21064317 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaa |
21064377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 27341593 - 27341533
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27341593 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
27341533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 28346759 - 28346703
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28346759 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 32726272 - 32726216
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32726272 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 43477161 - 43477221
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43477161 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
43477221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 2728597 - 2728542
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 10337118 - 10337177
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
10337118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
10337177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 190 - 249
Target Start/End: Complemental strand, 14239083 - 14239024
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14239083 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14239024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 35097692 - 35097637
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 4621354 - 4621296
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4621296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 7186004 - 7185946
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
7185946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 9496726 - 9496668
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9496726 |
taaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 11019517 - 11019575
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
11019517 |
taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 14489073 - 14489015
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
14489015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 16789369 - 16789311
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16789311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 42133154 - 42133096
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
42133096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 182 - 247
Target Start/End: Original strand, 5357413 - 5357477
Alignment:
| Q |
182 |
tttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||| |||||| ||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5357413 |
tttttaaata-ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 7420228 - 7420285
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
7420228 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 10337455 - 10337394
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
10337455 |
aaattaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 24090487 - 24090430
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgtaa |
24090430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 32725905 - 32725962
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
32725905 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 3511905 - 3511961
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
3511905 |
aggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 3512267 - 3512211
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
3512267 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 7326085 - 7326141
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
7326085 |
aggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 14495067 - 14495127
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
14495067 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
14495127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 16789069 - 16789133
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
16789069 |
aaataaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
16789133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 19494414 - 19494358
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 20984512 - 20984452
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
20984512 |
aaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
20984452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 326
Target Start/End: Original strand, 28497253 - 28497388
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgt |
290 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| |||||| |||||||||| ||||| ||||| |||||||||| |||| |
|
|
| T |
28497253 |
aaggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtccatgtaattttttttgttgtttttggtccctgcaaatatgaatcgt |
28497352 |
T |
|
| Q |
291 |
tttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| |
|
|
| T |
28497353 |
tttggttttggtccctgaccccacttttgtgatgat |
28497388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 29488112 - 29488052
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29488112 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
29488052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 32418316 - 32418376
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
32418316 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
32418376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 35097327 - 35097383
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
35097327 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 35346999 - 35346943
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
35346999 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 1778564 - 1778619
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 10873280 - 10873225
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 13232205 - 13232256
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13232205 |
atatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13232256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 17073806 - 17073865
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
17073806 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
17073865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 17574464 - 17574405
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
17574464 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
17574405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 20278058 - 20277999
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
20278058 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaa |
20277999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 21064685 - 21064626
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
21064685 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaa |
21064626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 25600229 - 25600288
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
25600229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgtaa |
25600288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 28497612 - 28497561
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28497612 |
atatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28497561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 29158353 - 29158412
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
29158353 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
29158412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 34963664 - 34963609
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 35346629 - 35346684
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 37536419 - 37536364
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 186 - 244
Target Start/End: Original strand, 1525802 - 1525860
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
1525802 |
taaaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 4375692 - 4375750
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
4375750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 185 - 251
Target Start/End: Complemental strand, 6146957 - 6146891
Alignment:
| Q |
185 |
ttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| || ||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6146957 |
ttaaaaaaagctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
6146891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 7272751 - 7272693
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| | ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgtaa |
7272693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 10776499 - 10776441
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
10776441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 191 - 249
Target Start/End: Original strand, 14238749 - 14238807
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
14238749 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14238807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 16644047 - 16643989
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
16644047 |
taaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
16643989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 40844156 - 40844214
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
40844214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 2728230 - 2728287
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
2728230 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 4017302 - 4017245
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
4017302 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 24187566 - 24187627
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24187566 |
taaggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgtaa |
24187627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 28324184 - 28324123
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
28324184 |
taaggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgtaa |
28324123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 192 - 249
Target Start/End: Complemental strand, 33526413 - 33526356
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33526413 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33526356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 1526173 - 1526117
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
1526173 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
1526117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 4473703 - 4473759
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
4473703 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 7272418 - 7272478
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
7272418 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaa |
7272478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 9175010 - 9175070
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
9175010 |
aaggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
9175070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 9496340 - 9496396
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
9496340 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 11976729 - 11976681
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
11976729 |
atatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 16643660 - 16643716
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16643660 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
16643716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 18549571 - 18549515
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgtaa |
18549515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 20277770 - 20277826
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
20277770 |
gtccctgcaaatatgcttcgttttggttttggtccctggccccacttttgtgatgat |
20277826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 21064397 - 21064453
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
21064397 |
gtccctgcaaatatgcttcgttttggttttggtccctggccccacttttgtgatgat |
21064453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 22650462 - 22650522
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
22650462 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
22650522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 25131109 - 25131169
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
25131109 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
25131169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 25600599 - 25600539
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
25600599 |
aaggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
25600539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 247
Target Start/End: Complemental strand, 27117978 - 27117922
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| | |||||||||| |||||| |
|
|
| T |
27117978 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 40066495 - 40066555
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
40066495 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgtaa |
40066555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 270 - 326
Target Start/End: Complemental strand, 42430042 - 42429986
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
42430042 |
gtccctgcaaatatgcctcgttttggttttggtccctggccccatttttgtgatgat |
42429986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 3680534 - 3680585
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
3680534 |
atatggttttgctccctgcaaatatgactcgttttggttttagtccctgtaa |
3680585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 189 - 248
Target Start/End: Original strand, 4016901 - 4016960
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| ||||| |||||||||| ||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
4016901 |
ataaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
4016960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 6469279 - 6469338
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
6469279 |
aggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgtaa |
6469338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 9175364 - 9175313
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
9175364 |
atatggttttggtccctgtaaatatgcctcgttttggttttagtctctgtaa |
9175313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 247
Target Start/End: Original strand, 10540448 - 10540503
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| |||| ||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
10540448 |
aggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 13154885 - 13154944
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||| |||||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13154885 |
aggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgtaa |
13154944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 18549200 - 18549259
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
18549200 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgtaa |
18549259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 191 - 250
Target Start/End: Original strand, 21125717 - 21125776
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
21125717 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
21125776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 24815069 - 24815010
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgtaa |
24815010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 247
Target Start/End: Complemental strand, 24955011 - 24954956
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
24955011 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct |
24954956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 25702511 - 25702570
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| |||||| ||||||||||||||| |
|
|
| T |
25702511 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgtaa |
25702570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 27117752 - 27117811
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
27117752 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgtaa |
27117811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 29992293 - 29992242
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
29992293 |
atatggttttgttccctgcaaatatgcctcgttttgattttagtccctgtaa |
29992242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 35345618 - 35345559
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| || |||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
35345618 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgtaa |
35345559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 40492959 - 40493018
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| || |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
40492959 |
aggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgtaa |
40493018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 42132864 - 42132919
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||| |||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 185 - 247
Target Start/End: Complemental strand, 1408361 - 1408299
Alignment:
| Q |
185 |
ttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||| ||||||||| |||||||||| ||||||||||||||||| | |||| |||||||||||| |
|
|
| T |
1408361 |
ttaattaaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct |
1408299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 191 - 245
Target Start/End: Original strand, 1685112 - 1685166
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1685112 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1685166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 192 - 246
Target Start/End: Complemental strand, 8094842 - 8094788
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccc |
246 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||| |||||||||||||||||| |
|
|
| T |
8094842 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 243
Target Start/End: Complemental strand, 13232562 - 13232512
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 189 - 247
Target Start/End: Original strand, 14496812 - 14496870
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||| |||||||||| || ||||||||||||| ||||||||||||||||||| |
|
|
| T |
14496812 |
ataaggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct |
14496870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 247
Target Start/End: Complemental strand, 25131447 - 25131393
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| |||||||||| || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 192 - 246
Target Start/End: Original strand, 33636321 - 33636375
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccc |
246 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
33636321 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
33636375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 38930667 - 38930609
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
38930667 |
taaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctg |
38930609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 42430120 - 42430062
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | | ||||||||||||||| ||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaa |
42430062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 1778641 - 1778698
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
1778641 |
ggtccttgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
1778698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 3680803 - 3680746
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||| ||||| |||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
3680803 |
aaggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 6146517 - 6146574
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| |||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaa |
6146574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 8298664 - 8298721
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
8298664 |
ggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgat |
8298721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 9175294 - 9175238
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
9175294 |
ggtccctgcaaatatgtctcgttttggttttggtcca-gaccccacttttgtgatgat |
9175238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 10540526 - 10540583
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
10540526 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
10540583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 24187899 - 24187842
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
24187899 |
aaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 200 - 245
Target Start/End: Original strand, 24814712 - 24814757
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
24814712 |
atatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 25600308 - 25600365
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
25600308 |
ggtccctgcaaatatgccttattttggttttggtccctgtctccacttttgtgatgat |
25600365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 247
Target Start/End: Original strand, 28323846 - 28323903
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||||| |||||||| | |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28323846 |
taaggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 277 - 326
Target Start/End: Complemental strand, 35115614 - 35115565
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||| |||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
35115614 |
caaatatacctcgttttggttttggtccctgaccccacttttgtgatgat |
35115565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 7420308 - 7420364
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
7420308 |
gtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
7420364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 8094478 - 8094534
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||| | |||||||||||||||||||| |
|
|
| T |
8094478 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg |
8094534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 13232276 - 13232332
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
13232276 |
gtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
13232332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 13779151 - 13779207
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgtaa |
13779207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 14488714 - 14488774
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| ||||| ||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
14488714 |
aaggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgtaa |
14488774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 19494118 - 19494174
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
19494118 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
19494174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 29991913 - 29991973
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||||||| ||||||||||||| |||||| ||||||||| |||||| |
|
|
| T |
29991913 |
aaggttaaaatatggttttggtctctgcaaatatgcctcgttttagttttagtctctgtaa |
29991973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 40844537 - 40844477
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
40844537 |
aaggttaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgtaa |
40844477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 42429756 - 42429815
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
42429756 |
aaggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctgtaa |
42429815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 44997929 - 44997989
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| ||||||| ||||| | ||||||| |
|
|
| T |
44997929 |
aaggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctgtaa |
44997989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 1162909 - 1162964
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
1162964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 244
Target Start/End: Complemental strand, 1163274 - 1163223
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||| |||||||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
1163274 |
ggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtc |
1163223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 2811524 - 2811575
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||| |||| ||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
2811524 |
tgcaaatatacctcattttggttttgatccatgaccccacttttgtgatgat |
2811575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 6469668 - 6469609
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6469668 |
aggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgtaa |
6469609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 13155252 - 13155193
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| || |||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
13155252 |
aggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgtaa |
13155193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 28399036 - 28398977
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28399036 |
aggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgtaa |
28398977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 42132947 - 42132998
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
42132947 |
tgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
42132998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 1778917 - 1778871
Alignment:
| Q |
205 |
gttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctgtaa |
1778871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 244
Target Start/End: Complemental strand, 2811784 - 2811730
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||| ||| ||||||||||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
2811784 |
taaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 194 - 244
Target Start/End: Complemental strand, 5357762 - 5357712
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc |
5357712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 247
Target Start/End: Complemental strand, 10755528 - 10755474
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 15719656 - 15719714
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtcccggtaa |
15719714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 38930299 - 38930357
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||| ||||||| ||||||| | ||||||||||||||| |||| |
|
|
| T |
38930299 |
taaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg |
38930357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 7326163 - 7326220
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
7326163 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgatgat |
7326220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 246
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccc |
246 |
Q |
| |
|
||||| ||||||| || ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 15930933 - 15930990
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||| ||||||| ||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgtaa |
15930990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 23360448 - 23360505
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||| || | ||||||||||||||| |
|
|
| T |
23360448 |
ggtccctgcaaatatgccttgttttggttttggtccttggcttcacttttgtgatgat |
23360505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 23939624 - 23939681
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||| |||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
23939624 |
ggtccctgcaaatatatctcgttttggttttagtccctgaccccacttttgtgatgat |
23939681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 30969399 - 30969456
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgtaa |
30969456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 36044791 - 36044734
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||||||||||||||| || | ||||||||||||| || |||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggttttaatctctgtaa |
36044734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 44998187 - 44998131
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
44998187 |
ggtccctgcaaatatgcctcattttggttttggtccctg-ctccacttttgtgatgat |
44998131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 270 - 326
Target Start/End: Original strand, 4473782 - 4473838
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
4473782 |
gtccctgcaaatatgccttattttggttttggtccctggctccacttttgtgatgat |
4473838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 271 - 323
Target Start/End: Complemental strand, 6469587 - 6469535
Alignment:
| Q |
271 |
tccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
6469587 |
tccatgcaaatatatctcattttggttttggtccctgaccccacttttgtgat |
6469535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 10776150 - 10776206
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| | ||||||||||||| ||| ||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaa |
10776206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 251
Target Start/End: Complemental strand, 13796602 - 13796538
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| || ||| ||||||||| | |||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
13796602 |
aaatacggttaaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctgtaa |
13796538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 247
Target Start/End: Original strand, 14847823 - 14847879
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||| ||| ||||| ||||| |||||||||||||||| | ||||||||||||||||| |
|
|
| T |
14847823 |
aaggttaaaatatgattttgatccctgcaaatatgcctcattttggttttagtccct |
14847879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 193 - 245
Target Start/End: Original strand, 33526052 - 33526104
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 35115640 - 35115584
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||| || |||||||||||| ||||||| |
|
|
| T |
35115640 |
aggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 35143845 - 35143789
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||| || ||||||||| |||||||||||||||||||| |
|
|
| T |
35143845 |
aggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 10873198 - 10873147
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || | ||| |||||||||||| |
|
|
| T |
10873198 |
tgcaaatatgcctcattttggttttggtccctggctccaattttgtgatgat |
10873147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 14847908 - 14847959
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
14847908 |
tgcaaatatgtctcgttttgattttggtccctagccccacttttgtgatgat |
14847959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 19962994 - 19963053
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||| || |||| |||||||||| | |||||| |||||||||||||||| |
|
|
| T |
19962994 |
aggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgtaa |
19963053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 21126022 - 21125963
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||| ||||| |||| || ||||||| | ||||||||||||||||||||||| |
|
|
| T |
21126022 |
aggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgtaa |
21125963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 24090202 - 24090253
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| |||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
24090202 |
tgcaaatatgtctcgttttggttttcgtccctagccccacttttgtgatgat |
24090253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 32040074 - 32040133
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| | || ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32040074 |
aggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
32040133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 36044708 - 36044657
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||| ||||||||||||||||||| || || ||||||||||||||| |
|
|
| T |
36044708 |
tgcaaatatatctcgttttggttttggtccctgacctcacttttgtgatgat |
36044657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 2728520 - 2728466
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
2728520 |
ggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgat |
2728466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 3512189 - 3512135
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
3512189 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
3512135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 4709983 - 4710037
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
4709983 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
4710037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 8298660 - 8298702
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
8298660 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
8298702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 9496646 - 9496592
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
9496646 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
9496592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 10540522 - 10540564
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
10540522 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
10540564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 11019597 - 11019651
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
11019597 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
11019651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 11976659 - 11976605
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
11976659 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
11976605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 17074095 - 17074053
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
17074095 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17074053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 17574175 - 17574217
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
17574175 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17574217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 243
Target Start/End: Original strand, 23939547 - 23939597
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| | |||||| |||||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 23939620 - 23939662
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
23939620 |
ttttggtccctgcaaatatatctcgttttggttttagtccctg |
23939662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 28346681 - 28346627
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
28346681 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
28346627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 29158669 - 29158611
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtccttgtaa |
29158611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 227
Target Start/End: Complemental strand, 30969717 - 30969683
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgcc |
227 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatgcc |
30969683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 34963377 - 34963431
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
34963377 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
34963431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 35097615 - 35097561
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
35097615 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
35097561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 37536342 - 37536288
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
37536342 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
37536288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 42430047 - 42430005
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
42430047 |
tttttgtccctgcaaatatgcctcgttttggttttggtccctg |
42430005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 44998191 - 44998149
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
44998191 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
44998149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 247
Target Start/End: Original strand, 2355884 - 2355941
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||||| |||| | |||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
2355884 |
taaggctaaaatataggtttgatccctgcaaatataccttgttttggttttagtccct |
2355941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 2355962 - 2356019
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| | || || ||||||||||||||| |
|
|
| T |
2355962 |
ggtccctgcaaatatgtttcgttttggttttggttcctgacctcacttttgtgatgat |
2356019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 275 - 304
Target Start/End: Complemental strand, 3680778 - 3680749
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtcc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3680778 |
tgcaaatatgcctcgttttggttttggtcc |
3680749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 5357686 - 5357629
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||| || |||| |||||||||| || | |||||||||||||||| |
|
|
| T |
5357686 |
ggtccctgcaaatatgcttcattttagttttggtccctgactccacttttgtgatgat |
5357629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 9832205 - 9832273
Alignment:
| Q |
182 |
tttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
9832205 |
tttttaaa-aaggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgtaa |
9832273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 225
Target Start/End: Complemental strand, 25702810 - 25702777
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatg |
225 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
25702810 |
aggctaaaatatggttttggtccctgcaaatatg |
25702777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 239
Target Start/End: Complemental strand, 30337220 - 30337171
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttt |
239 |
Q |
| |
|
||||||||| |||| ||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
30337220 |
taaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 191 - 244
Target Start/End: Complemental strand, 31445465 - 31445412
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||||||| | |||||||||||||| |
|
|
| T |
31445465 |
aaggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc |
31445412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 193 - 238
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggtt |
238 |
Q |
| |
|
|||||| || ||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 244
Target Start/End: Complemental strand, 4376011 - 4375960
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| || ||||||||||||| |
|
|
| T |
4376011 |
aggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc |
4375960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 200 - 244
Target Start/End: Complemental strand, 17074161 - 17074117
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
17074161 |
atatggttttggtccctgcaaatatgtcgggttttgattttagtc |
17074117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 200 - 244
Target Start/End: Original strand, 17574109 - 17574153
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
17574109 |
atatggttttggtccctgcaaatatgtcgggttttgattttagtc |
17574153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 23939912 - 23939852
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| ||||||||||| | |||||||||||| | |||||||| |||||||| ||||| |
|
|
| T |
23939912 |
aaggttaaaatatggttttgattcctgcaaatatgactcgttttggctttagtccatgtaa |
23939852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 26530666 - 26530726
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| | |||||||||| |||| |||||||||||| | |||| |||||||| ||||||| |
|
|
| T |
26530666 |
aaggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctgtaa |
26530726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 245
Target Start/End: Original strand, 29487750 - 29487802
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 290 - 326
Target Start/End: Complemental strand, 29992203 - 29992167
Alignment:
| Q |
290 |
ttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| |
|
|
| T |
29992203 |
ttttggttttggtccctgaccccacttttgtgatgat |
29992167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 43727097 - 43727153
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgtaa |
43727153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 43727431 - 43727376
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| |||| |||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccttgtaa |
43727376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 245
Target Start/End: Complemental strand, 44998263 - 44998211
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||| ||||||||||| || || |||||||| | ||||||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtcc |
44998211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 165)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 326
Target Start/End: Original strand, 25136992 - 25137127
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgt |
290 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||| | |
|
|
| T |
25136992 |
aaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaattgttgtttttggtccctgcaaatatgcctcat |
25137091 |
T |
|
| Q |
291 |
tttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||| || | |||||||||||||||| |
|
|
| T |
25137092 |
tttggttttggtccctggctccacttttgtgatgat |
25137127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 1007510 - 1007451
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1007510 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
1007451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 3414386 - 3414445
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3414386 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3414445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 3969010 - 3968951
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3969010 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3968951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 25137358 - 25137299
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25137358 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25137299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 186 - 251
Target Start/End: Original strand, 19690386 - 19690451
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
19690386 |
taaaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19690451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 183 - 251
Target Start/End: Original strand, 21147393 - 21147462
Alignment:
| Q |
183 |
ttttaaata-aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21147393 |
ttttaaatataggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgtaa |
21147462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 12299142 - 12299082
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
12299142 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaa |
12299082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 12757604 - 12757668
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
12757604 |
aaataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgtaa |
12757668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 187 - 251
Target Start/End: Complemental strand, 14656266 - 14656202
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
14656266 |
aaataaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
14656202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 21994404 - 21994348
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21994404 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 22543353 - 22543409
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22543353 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 1007123 - 1007182
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1007123 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaa |
1007182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 188 - 251
Target Start/End: Complemental strand, 3276359 - 3276296
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
3276359 |
aataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
3276296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 10910965 - 10910906
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
10910965 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
10910906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 6412582 - 6412524
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
6412582 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 190 - 326
Target Start/End: Original strand, 13268106 - 13268243
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt-aannnnnnnnnnnnnnnnnggtccatgcaaatatgcctc |
288 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||| | || ||||| |||||||||| ||| |
|
|
| T |
13268106 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccctataaaaataatttgatgtttttggtccctgcaaatatgtctc |
13268205 |
T |
|
| Q |
289 |
gttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |
|
|
| T |
13268206 |
gttttggttttggtccctgaccccacttttgtgatgat |
13268243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 15962389 - 15962331
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
15962331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 24274134 - 24274076
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24274134 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24274076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 34582529 - 34582587
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
34582587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 3968643 - 3968700
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
3968643 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 12298895 - 12298952
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
12298895 |
ggtccatgcaaatatgtctcgttttggttttggtccctggccccacttttgtgatgat |
12298952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 15076206 - 15076149
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15076206 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15076149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 21385249 - 21385306
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
21385249 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 21385586 - 21385529
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
21385586 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 186 - 251
Target Start/End: Complemental strand, 25431861 - 25431796
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
25431861 |
taaattaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25431796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 33801745 - 33801688
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33801745 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33801688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 6412217 - 6412273
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
6412217 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 203 - 318
Target Start/End: Complemental strand, 6564934 - 6564819
Alignment:
| Q |
203 |
tggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgttttggttttggt |
302 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6564934 |
tggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaattttttgttttgtttttggtccatgcaaatatgcctcgttttggttttggt |
6564835 |
T |
|
| Q |
303 |
ccatgtccccactttt |
318 |
Q |
| |
|
|| || |||||||||| |
|
|
| T |
6564834 |
ccttgaccccactttt |
6564819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 7156161 - 7156105
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7156161 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7156105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 13617531 - 13617587
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaa |
13617587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 20467719 - 20467663
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
20467719 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 21995062 - 21995122
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
21995062 |
aaggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgtaa |
21995122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 22543719 - 22543663
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
22543719 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 30928679 - 30928739
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
30928679 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
30928739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 18024376 - 18024317
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
18024376 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
18024317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 19129521 - 19129462
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
19129521 |
aggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgtaa |
19129462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 243
Target Start/End: Complemental strand, 19321132 - 19321081
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19321132 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 21993786 - 21993845
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
21993786 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaa |
21993845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 34582893 - 34582834
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
34582893 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgtaa |
34582834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 494405 - 494463
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
494463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 13617804 - 13617758
Alignment:
| Q |
205 |
gttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13617758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 19296407 - 19296349
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
19296349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 200 - 250
Target Start/End: Complemental strand, 26376038 - 26375988
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26376038 |
atatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
26375988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 30929044 - 30928986
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30928986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 194 - 248
Target Start/End: Original strand, 31166871 - 31166925
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
31166925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 181 - 251
Target Start/End: Complemental strand, 33131861 - 33131792
Alignment:
| Q |
181 |
ctttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33131861 |
ctttttaaa-aaggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgtaa |
33131792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 3414754 - 3414697
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
3414754 |
aaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 7155795 - 7155852
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7155795 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7155852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 8681118 - 8681061
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8681118 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
8681061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 14428651 - 14428708
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| |||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
14428708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 20467349 - 20467406
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| ||| |||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20467349 |
aaggataaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 22822653 - 22822596
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
22822653 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
22822596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 240
Target Start/End: Original strand, 23502235 - 23502284
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23502235 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 23502543 - 23502482
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
23502543 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgtaa |
23502482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 23770162 - 23770219
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
23770219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 30479421 - 30479364
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||||| | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgtaa |
30479364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 34990318 - 34990257
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34990318 |
taaggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
34990257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 543368 - 543416
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
543368 |
atatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
543416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 1890453 - 1890397
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
1890453 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
1890397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 3356140 - 3356200
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3356140 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccttgtaa |
3356200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 244
Target Start/End: Complemental strand, 8170152 - 8170100
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
8170152 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 8680774 - 8680830
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8680774 |
aggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8680830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 11449171 - 11449111
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||||| |||||||||| |||||||||||| |
|
|
| T |
11449171 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgtaa |
11449111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 12419939 - 12419883
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12419939 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
12419883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 14655378 - 14655434
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14655378 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
14655434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 15962026 - 15962082
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
15962026 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 243
Target Start/End: Original strand, 17765007 - 17765059
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
17765007 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 19129343 - 19129391
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19129343 |
atatggctttggtccctgcaaatatgcctcgttttggttttagtccctg |
19129391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 193 - 249
Target Start/End: Original strand, 19267565 - 19267621
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgt |
19267621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 19267914 - 19267854
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||| |||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
19267914 |
aaggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgtaa |
19267854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 22792901 - 22792841
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||| | ||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
22792901 |
aaggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccccgtaa |
22792841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 32885672 - 32885728
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32885672 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
32885728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 188 - 247
Target Start/End: Original strand, 1214691 - 1214750
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| | | ||||||||||||||||| |
|
|
| T |
1214691 |
aataaggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 191 - 250
Target Start/End: Original strand, 2373177 - 2373236
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
2373177 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgta |
2373236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 247
Target Start/End: Original strand, 2615871 - 2615926
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| || ||||||||||||||||||| |
|
|
| T |
2615871 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 247
Target Start/End: Complemental strand, 3356491 - 3356444
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3356491 |
atatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3356444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 7324185 - 7324134
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7324185 |
atatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
7324134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 12176636 - 12176585
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
12176636 |
atatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
12176585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 12612360 - 12612301
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||| || ||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
12612360 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
12612301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 12757860 - 12757805
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatg |
324 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| || |||||||||||||||| |
|
|
| T |
12757860 |
ggtccttgcaaatatgcatcgttttggttttggtccctggccccacttttgtgatg |
12757805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 18024018 - 18024069
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18024018 |
atatggttttggtctttgcaaatatgcctcgttttggttttagtccctgtaa |
18024069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 244
Target Start/End: Original strand, 24901239 - 24901290
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 25121497 - 25121438
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25121497 |
aggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgtaa |
25121438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 191 - 249
Target Start/End: Original strand, 6468308 - 6468366
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6468308 |
aaggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgt |
6468366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 10910629 - 10910687
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||| || |||||||| | ||||||||||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgtaa |
10910687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 17771911 - 17771969
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
17771969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 21995425 - 21995367
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgtaa |
21995367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 31186591 - 31186533
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| || |||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgtaa |
31186533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 1007201 - 1007258
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
1007201 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
1007258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 195 - 248
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
5286896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 11448534 - 11448595
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
11448534 |
taaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccccgtaa |
11448595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 277 - 326
Target Start/End: Complemental strand, 11925949 - 11925900
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11925949 |
caaatatgtctcgttttggttttggtccatagccccacttttgtgatgat |
11925900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 245
Target Start/End: Original strand, 12419707 - 12419760
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
12419707 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 19320844 - 19320901
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
19320844 |
ggtccttgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
19320901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 24273826 - 24273883
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
24273826 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 24901315 - 24901372
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
24901315 |
ggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgat |
24901372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 27765097 - 27765040
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
27765097 |
ggtccctgcaaatatgtctcgttttggttttggtctctggccccacttttgtgatgat |
27765040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 31198692 - 31198749
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
31198692 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
31198749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 17765377 - 17765317
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
17765377 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgtaa |
17765317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 19296106 - 19296166
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| | |||||||| |||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
19296106 |
aaggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgtaa |
19296166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 19320769 - 19320825
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | | ||||||||||| ||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgtaa |
19320825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 24692980 - 24692924
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
24692980 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 26375691 - 26375751
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
26375691 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgtaa |
26375751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 33808619 - 33808675
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||| ||||||||| ||||||| |||||||||||| |
|
|
| T |
33808619 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
33808675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 317811 - 317870
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||| ||||| ||||||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
317811 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctgtaa |
317870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 318098 - 318039
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
318098 |
aggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgtaa |
318039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 247
Target Start/End: Complemental strand, 1214997 - 1214942
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| ||||||||||| || ||||||||||| | ||||||||||||||||||| |
|
|
| T |
1214997 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 10091043 - 10091094
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10091043 |
atatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
10091094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 12298829 - 12298876
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
12298829 |
atatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 322
Target Start/End: Original strand, 14655986 - 14656033
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtga |
322 |
Q |
| |
|
||||||||||| |||||||||||||||||| || |||||||||||||| |
|
|
| T |
14655986 |
tgcaaatatgcatcgttttggttttggtccctggccccacttttgtga |
14656033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 15722609 - 15722668
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
15722609 |
aggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgtaa |
15722668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 31167200 - 31167145
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg |
31167145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 245
Target Start/End: Complemental strand, 9896639 - 9896585
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
9896639 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 11925739 - 11925797
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||| | ||||||| |||||||| |||||| |
|
|
| T |
11925739 |
ggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtctctgtaa |
11925797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 14655903 - 14655961
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgtaa |
14655961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 243
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 19690471 - 19690529
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtc-catgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
19690471 |
ggtccttgcaaatatgtctcgttttggttttggtctcatggcccaacttttgtgatgat |
19690529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 238
Target Start/End: Original strand, 30479062 - 30479108
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggtt |
238 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
30479062 |
aggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 31276328 - 31276282
Alignment:
| Q |
205 |
gttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
31276328 |
gttttggtccctgcaaatatgtctcgttttgattttagtccctgtaa |
31276282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 494751 - 494694
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| | ||||||||||||| ||| ||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaa |
494694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 777675 - 777732
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||| |||| || ||||||||||| || |||||||||||||||||||| |
|
|
| T |
777675 |
aaggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg |
777732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 1890057 - 1890114
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| ||| |||||||||| ||||||| ||||||||| ||||||| |||||||||||| |
|
|
| T |
1890057 |
aaggttaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
1890114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 191 - 240
Target Start/End: Complemental strand, 2616242 - 2616193
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
2616242 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 6564595 - 6564636
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
6564595 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 191 - 240
Target Start/End: Original strand, 6591113 - 6591162
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
6591113 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 10910887 - 10910830
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||| || ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
10910887 |
ggtccctgcaaatatgcatcattttggttttggtccttggctccacttttgtgatgat |
10910830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 14428953 - 14428892
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||| |||||||||| |||| ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
14428953 |
taagactaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccttgtaa |
14428892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 318
Target Start/End: Original strand, 19129353 - 19129402
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccactttt |
318 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||| || |||||||||| |
|
|
| T |
19129353 |
ggtccctgcaaatatgcctcgttttggttttagtccctggccccactttt |
19129402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 23628799 - 23628856
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcactgtaa |
23628856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 25121420 - 25121363
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||| ||||| ||||||||| || |||||||||||||||||| |
|
|
| T |
25121420 |
ggtccctgcaaatatgtctcattttgattttggtccctggccccacttttgtgatgat |
25121363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 13150752 - 13150692
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13150752 |
aaggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgtaa |
13150692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 227
Target Start/End: Complemental strand, 15117046 - 15117006
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgcc |
227 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
15117046 |
aaataaggctaaaatatggttttagtccctgcaaatatgcc |
15117006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 321
Target Start/End: Complemental strand, 19267837 - 19267785
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtg |
321 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
19267837 |
ggtccctgcaaatatgtctcattttggttttggtccctgaccccacttttgtg |
19267785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 243
Target Start/End: Original strand, 22822305 - 22822357
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||||| |||||||||| ||| |||||||||| || ||||||||||||||| |
|
|
| T |
22822305 |
aaggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 31398543 - 31398483
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||| | | ||||||||||||||| ||||| |
|
|
| T |
31398543 |
aaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtccttgtaa |
31398483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 243
Target Start/End: Complemental strand, 778043 - 777992
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| |||||| |||||||| |
|
|
| T |
778043 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 11926034 - 11925975
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||| ||| ||||||| | ||||||||||||||| | ||||| |
|
|
| T |
11926034 |
aggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagttcttgtaa |
11925975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 19690752 - 19690702
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||||||| ||||| |
|
|
| T |
19690752 |
atatggttttggtccctgcaaatatgtctcgtttt-gttttagtccgtgtaa |
19690702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 24901555 - 24901496
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||| ||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
24901555 |
aggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgtaa |
24901496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 31276110 - 31276157
Alignment:
| Q |
201 |
tatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||| | |||||||||| ||||||| |
|
|
| T |
31276110 |
tatggttttggtccctacaaatatgcctcattttggttttggtccctg |
31276157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 194 - 245
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 1007197 - 1007239
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
1007197 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1007239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 1214767 - 1214809
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
1214767 |
ttttggtccctgcaaatatgtcttgttttggttttagtccctg |
1214809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 3968722 - 3968776
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
3968722 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
3968776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 6412502 - 6412448
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
6412502 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
6412448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 243
Target Start/End: Original strand, 12611995 - 12612045
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||| ||||||| || |||||||||||||||||| ||||| |||||||| |
|
|
| T |
12611995 |
ggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagt |
12612045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 19129447 - 19129405
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||| |
|
|
| T |
19129447 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
19129405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 244
Target Start/End: Complemental strand, 19275223 - 19275185
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
19275185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 21994326 - 21994272
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
21994326 |
ggtccctgcaaatatgtctctttttggttttggtccctggctccacttttgtgat |
21994272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 22543641 - 22543587
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
22543641 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
22543587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 303
Target Start/End: Original strand, 23502254 - 23502288
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtc |
303 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23502254 |
ggtccctgcaaatatgcctcgttttggttttggtc |
23502288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 234
Target Start/End: Complemental strand, 23770440 - 23770398
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgtttt |
234 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
23770440 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 24901311 - 24901353
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
24901311 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24901353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 247
Target Start/End: Original strand, 30239293 - 30239347
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| ||||| |||| || |||||||||||| | ||||||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 30479136 - 30479190
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
30479136 |
ggtccctgcaaatatatctcgttttagttttggtccctggccccacttttgtgat |
30479190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 31198688 - 31198730
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
31198688 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
31198730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 326
Target Start/End: Complemental strand, 3276269 - 3276220
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||| |||||||||||||| || | |||||||||||||||| |
|
|
| T |
3276269 |
caaatatgcctcattttggttttggtctctggctccacttttgtgatgat |
3276220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 13617606 - 13617663
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| | | |||||||||||||||| |
|
|
| T |
13617606 |
ggtccctgcaaatatgcctcattttggttttggtctctagctccacttttgtgatgat |
13617663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 17765298 - 17765241
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| | | | |||||||||||||| |
|
|
| T |
17765298 |
ggtccctgcaaatatgcctcattttggttttggtccctagctcaacttttgtgatgat |
17765241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 17765302 - 17765261
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| |||||| |
|
|
| T |
17765302 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
17765261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 543725 - 543669
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||| |||| |||||||||||||||| |||||||||||| |||||| |
|
|
| T |
543725 |
aggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctg |
543669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 243
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||| |||||||||| || |||||||||||| | ||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #165
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 9896280 - 9896336
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| |||||||||||||| | | |||| |||||||||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctgtaa |
9896336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 187)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 19685382 - 19685322
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19685382 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
19685322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 38170512 - 38170572
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38170512 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38170572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 24443745 - 24443686
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24443745 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24443686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 1381614 - 1381556
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1381614 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 5917463 - 5917405
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5917463 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 186 - 248
Target Start/End: Original strand, 35928057 - 35928119
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35928057 |
taaaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 40764412 - 40764470
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40764412 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 29172892 - 29172831
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29172892 |
aaataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 1105149 - 1105093
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1105149 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 1381245 - 1381305
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
1381245 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
1381305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 2217492 - 2217552
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2217492 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2217552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 7075570 - 7075630
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7075570 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
7075630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 19565832 - 19565776
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19565832 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 20660946 - 20661006
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
20660946 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccttgtaa |
20661006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 28863508 - 28863568
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28863508 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28863568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 36578085 - 36578025
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36578085 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
36578025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 1104857 - 1104916
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
1104857 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
1104916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 5950175 - 5950234
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5950175 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
5950234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 6912497 - 6912552
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 189 - 248
Target Start/End: Original strand, 24443376 - 24443435
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
24443376 |
ataaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 29692743 - 29692802
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29692743 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29692802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 30800493 - 30800552
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30800493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30800552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 30800851 - 30800792
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30800851 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30800792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 37271358 - 37271417
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37271358 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaa |
37271417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 185 - 251
Target Start/End: Complemental strand, 40029506 - 40029439
Alignment:
| Q |
185 |
ttaaataa-ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40029506 |
ttaaataatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
40029439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 45138 - 45196
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
45196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 185 - 251
Target Start/End: Complemental strand, 6912865 - 6912799
Alignment:
| Q |
185 |
ttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||| |||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
6912865 |
ttaaaaaagactaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
6912799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 28863838 - 28863780
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28863780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 35928458 - 35928400
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35928400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 1286970 - 1286913
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1286970 |
ggtccctgcaaatatgcctcattttggttttggtccctgtccccacttttgtgatgat |
1286913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 4736545 - 4736484
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4736545 |
taaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaa |
4736484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 15635713 - 15635652
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||| |||||||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
15635713 |
aaataaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
15635652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 182 - 251
Target Start/End: Complemental strand, 18046359 - 18046290
Alignment:
| Q |
182 |
tttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||| ||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18046359 |
ttttttaattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
18046290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 18633597 - 18633654
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18633597 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18633654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 19565465 - 19565522
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
19565465 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 20986091 - 20986034
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
20986091 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 326
Target Start/End: Original strand, 28213371 - 28213507
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa-nnnnnnnnnnnnnnnnnggtccatgcaaatatgcctcg |
289 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| | ||||||||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
28213371 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccatgtaatttttttttgttatttttggtccctgcaaatatgcctcg |
28213470 |
T |
|
| Q |
290 |
ttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| |
|
|
| T |
28213471 |
ttttggttttggtctctggccccacttttgtgatgat |
28213507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 28871997 - 28871936
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
28871997 |
taaggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaa |
28871936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 193 - 250
Target Start/End: Original strand, 30888160 - 30888217
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
30888217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 35167167 - 35167110
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35167167 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 35876686 - 35876743
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35876686 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 40764782 - 40764725
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40764782 |
aaggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 5917125 - 5917181
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
5917125 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 10743722 - 10743782
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
10743722 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
10743782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 16038375 - 16038435
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
16038375 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
16038435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 18258529 - 18258469
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
18258529 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
18258469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 19685016 - 19685072
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
19685016 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 20985732 - 20985780
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20985732 |
atatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 26133415 - 26133355
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26133415 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
26133355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 193 - 249
Target Start/End: Original strand, 28550827 - 28550883
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28550883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 29875726 - 29875670
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29875726 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29875670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 187 - 251
Target Start/End: Complemental strand, 34125638 - 34125574
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
34125638 |
aaataaggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaa |
34125574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 38786157 - 38786217
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38786157 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
38786217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 40167784 - 40167844
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40167784 |
aaggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
40167844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 247
Target Start/End: Complemental strand, 2217855 - 2217800
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
2217800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 194 - 245
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 5614531 - 5614472
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
5614531 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
5614472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 11799459 - 11799400
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgtaa |
11799400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 189 - 248
Target Start/End: Original strand, 18258158 - 18258217
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| | | |||||||||||||||||| |
|
|
| T |
18258158 |
ataaggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 20690732 - 20690791
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
20690732 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
20690791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 28108155 - 28108104
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
28108155 |
atatggttttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
28108104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 35877053 - 35876994
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
35877053 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaa |
35876994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 36577721 - 36577780
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
36577721 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36577780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 1286682 - 1286740
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
1286740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 20661311 - 20661253
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgtaa |
20661253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 26133183 - 26133241
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
26133241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 194 - 248
Target Start/End: Original strand, 29172524 - 29172578
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 33336026 - 33335968
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaa |
33335968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 35609303 - 35609361
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgtaa |
35609361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 243
Target Start/End: Original strand, 4203453 - 4203506
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
4203453 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 10408926 - 10408983
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
10408926 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
10408983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 13990898 - 13990837
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||| |||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
13990898 |
taaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
13990837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 187 - 248
Target Start/End: Original strand, 29875394 - 29875455
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29875394 |
aaataaggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg |
29875455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 37271708 - 37271651
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
37271708 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 293826 - 293886
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
293826 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccatgtaa |
293886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 9179922 - 9179862
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
9179922 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgtaa |
9179862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 18046036 - 18046096
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
18046036 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
18046096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 21124911 - 21124971
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
21124911 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
21124971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 4203771 - 4203712
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
4203771 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
4203712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 5904007 - 5904066
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
5904007 |
aggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgtaa |
5904066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 6118499 - 6118444
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
6118444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 10744055 - 10743996
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
10744055 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
10743996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 10830612 - 10830663
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
10830612 |
tgcaaatatggctcgttttggttttggtccctgaccccacttttgtgatgat |
10830663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 18633961 - 18633906
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctg |
18633906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 25561705 - 25561760
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
25561760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 29151855 - 29151796
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
29151855 |
ataaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg |
29151796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 32888694 - 32888745
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
32888694 |
atatggttttggtccctgcaaatattcctcgttttcgttttagtccctgtaa |
32888745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 34125306 - 34125365
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||| ||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
34125306 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
34125365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 38496786 - 38496727
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38496786 |
ataaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
38496727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 42596810 - 42596759
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
42596810 |
atatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaa |
42596759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 192 - 250
Target Start/End: Original strand, 12144906 - 12144964
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
||||||| |||||||||| ||||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
12144906 |
aggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgta |
12144964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 21050913 - 21050855
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgtaa |
21050855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 29366949 - 29366891
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
29366891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 36973710 - 36973652
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||| | ||||||| ||||||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaa |
36973652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 40038858 - 40038800
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgtaa |
40038800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 42553642 - 42553700
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
42553700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 11799127 - 11799184
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11799127 |
aaggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 251
Target Start/End: Original strand, 17070528 - 17070592
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||| | || |||| ||||||||||||||| |
|
|
| T |
17070528 |
taaaaaaggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctgtaa |
17070592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 20661025 - 20661082
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||| ||||| ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
20661025 |
ggtccttgcagatatgtctcgttttggttttggtccctgaccccacttttgtgatgat |
20661082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 20683744 - 20683805
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
20683744 |
taaggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgtaa |
20683805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 24781988 - 24782045
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
24781988 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24782045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 241
Target Start/End: Complemental strand, 25562000 - 25561951
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
25562000 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 245
Target Start/End: Complemental strand, 39379611 - 39379558
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
39379611 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
39379558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 40029138 - 40029199
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||| ||||||| | ||||||||||||| ||||||||| |
|
|
| T |
40029138 |
taaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgtaa |
40029199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 3850592 - 3850544
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
3850592 |
atatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 5614164 - 5614224
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||| ||||||||| ||||| |
|
|
| T |
5614164 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
5614224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 9532537 - 9532477
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||| |||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
9532537 |
aaggttaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaa |
9532477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 244
Target Start/End: Complemental strand, 10409327 - 10409275
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||| |||||||| |
|
|
| T |
10409327 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 16038738 - 16038682
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||| |||| ||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgtaa |
16038682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 187 - 243
Target Start/End: Complemental strand, 18286747 - 18286691
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||||||||| | |||||||| |||||||||||||| || ||||||||||||||| |
|
|
| T |
18286747 |
aaataaggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 193 - 245
Target Start/End: Complemental strand, 23382297 - 23382245
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 187 - 251
Target Start/End: Complemental strand, 25779168 - 25779104
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||| |||||||||| |||||||||||||||| | ||||||||||||| ||||||| |
|
|
| T |
25779168 |
aaattaggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgtaa |
25779104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 26071618 - 26071558
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| ||||| ||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26071618 |
aaggttaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgtaa |
26071558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 27916766 - 27916706
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||| |||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
27916766 |
aaggttaaaatatggttttattccctgcaaatatgcctcgttttggttttagtctctgtaa |
27916706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 28871631 - 28871695
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| ||| ||||| ||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
28871631 |
aaattaggttaaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgtaa |
28871695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 29693092 - 29693032
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| |||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
29693092 |
aaggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
29693032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 190 - 242
Target Start/End: Original strand, 35166908 - 35166960
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttag |
242 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
35166908 |
taaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 243
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 39379246 - 39379294
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| |||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39379246 |
atatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 244
Target Start/End: Original strand, 2636669 - 2636720
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | | |||||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 3850299 - 3850358
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttgg-ttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||||||||| |||| |||||||| ||||||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctgtaa |
3850358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 9179592 - 9179651
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgtaa |
9179651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 10830528 - 10830587
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||| || |||||||||| |||||||||||||| ||||||| |
|
|
| T |
10830528 |
aggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgtaa |
10830587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 14318044 - 14318103
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
14318044 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccttgtaa |
14318103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 23381949 - 23382008
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
23381949 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgtaa |
23382008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 29151516 - 29151571
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
29151571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 31037742 - 31037683
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||| || |||||| |
|
|
| T |
31037742 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctctgtaa |
31037683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 326
Target Start/End: Original strand, 32108807 - 32108941
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgtt |
291 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||| |||||| ||||||||| ||||| |||||||||||||| || |
|
|
| T |
32108807 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgtaaaaaaaattgttgtttttggtccctgcaaatatgcctcatt |
32108906 |
T |
|
| Q |
292 |
ttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| || || | |||||||||||||||| |
|
|
| T |
32108907 |
ttggttttggcccgtggctccacttttgtgatgat |
32108941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 247
Target Start/End: Complemental strand, 38555084 - 38555030
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
38555084 |
aggctaaaatatggttt-ggtccctgcaaatatgcctcattttggttttagtccct |
38555030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 40038493 - 40038552
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||| ||||||| ||||| ||| ||||| |
|
|
| T |
40038493 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttgattttaatccgtgtaa |
40038552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 40168009 - 40167950
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||| ||||| |||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
40168009 |
aggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgtaa |
40167950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 42207241 - 42207300
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||| || ||||||| | ||||||||||||||||||||||| |
|
|
| T |
42207241 |
aggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgtaa |
42207300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 42596536 - 42596587
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||||||| ||||||||| || ||||||||||||||||| |
|
|
| T |
42596536 |
tgcaaatatgcctcgttttgattttggtccttggtcccacttttgtgatgat |
42596587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 2032932 - 2032882
Alignment:
| Q |
201 |
tatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
2032932 |
tatggttttagtccctgcaaatatgtctcgttttggttttagtccatgtaa |
2032882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 247
Target Start/End: Original strand, 15916286 - 15916340
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| | |||||||||||||||||||||||| | | ||||||||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 250
Target Start/End: Original strand, 26071290 - 26071348
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
||||||| |||| |||| |||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgta |
26071348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 1105071 - 1105014
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | ||| |||||||||||| |
|
|
| T |
1105071 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccaattttgtgatgat |
1105014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 2636746 - 2636803
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
2636746 |
ggtccctgcaaatatgccttattttggttttggtccctggctccacttttgtgatgat |
2636803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 206 - 251
Target Start/End: Complemental strand, 9588598 - 9588553
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
9588598 |
ttttggtccctgcaaatatgtctcgttttggttttagtccatgtaa |
9588553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 15916371 - 15916420
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||| ||||||||||||||||||| || || ||||||||||||||| |
|
|
| T |
15916371 |
caaatatgtctcgttttggttttggtccctgacctcacttttgtgatgat |
15916420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 17070612 - 17070669
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| || ||||||| |||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
17070612 |
ggtccctgtaaatatggctcgttttggttttggcccctgaccccacttttgtgatgat |
17070669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 20416357 - 20416418
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| | || |||||||| |||||| |||| |
|
|
| T |
20416357 |
taaggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtcccggtaa |
20416418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 29855614 - 29855671
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||| ||||||||| || ||||||||| | ||||||||||||||||||||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgtaa |
29855671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 187 - 251
Target Start/End: Original strand, 38554745 - 38554807
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||| ||||||||||| ||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
38554745 |
aaattaggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagtctctgtaa |
38554807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 1287047 - 1286987
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||||||||||| ||||||| | | ||||||||||||| ||||||| |
|
|
| T |
1287047 |
aaggttaaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgtaa |
1286987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 35166151 - 35166103
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| ||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
35166151 |
atatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg |
35166103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 38452394 - 38452338
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | ||||||| ||||| || |||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttaatctctgtaa |
38452338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 249
Target Start/End: Complemental strand, 1286974 - 1286931
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
1286974 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgt |
1286931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 3851330 - 3851271
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||| | ||||||| ||||||||||||||| |
|
|
| T |
3851330 |
aggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgtaa |
3851271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 4736459 - 4736408
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||| |||||||||| |||| || | |||||||||||||||| |
|
|
| T |
4736459 |
tgcaaatatgcctcattttggtttttgtccctgactccacttttgtgatgat |
4736408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 26071373 - 26071424
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||||||| |||| ||| || |||||||||||||||||| |
|
|
| T |
26071373 |
tgcaaatatgcctcgttttgattttagtctctgaccccacttttgtgatgat |
26071424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 269 - 328
Target Start/End: Original strand, 28871715 - 28871774
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgatgt |
328 |
Q |
| |
|
||||| |||||||||| ||| |||||||||| |||| || | |||||||||||||||||| |
|
|
| T |
28871715 |
ggtccctgcaaatatgtctcattttggttttagtccctggctccacttttgtgatgatgt |
28871774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 190 - 249
Target Start/End: Complemental strand, 42207575 - 42207517
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||| |||| |||||||||| |||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
42207575 |
taagcctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctgt |
42207517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 1105075 - 1105033
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
1105075 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1105033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 1381534 - 1381480
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
1381534 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
1381480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 243
Target Start/End: Complemental strand, 5104001 - 5103951
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||| | | ||||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 6912575 - 6912629
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
6912575 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
6912629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 15635373 - 15635431
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| ||| |||||||||| |||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
15635373 |
taaggataaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg |
15635431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 21050575 - 21050633
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| |||||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgtaa |
21050633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 24443457 - 24443511
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
24443457 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
24443511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 28871711 - 28871753
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||||||||||| |
|
|
| T |
28871711 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
28871753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 244
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
31602259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 35876765 - 35876819
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
35876765 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
35876819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 35928141 - 35928195
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
35928141 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
35928195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 243
Target Start/End: Original strand, 36973353 - 36973403
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||| |||||||||||||| || |||||||| | ||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 37271629 - 37271575
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
37271629 |
ggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgat |
37271575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 243
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||| |||||||||| ||||||| ||||||| | ||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 40764492 - 40764546
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
40764492 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
40764546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 241
Target Start/End: Complemental strand, 45497 - 45456
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45497 |
atatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 6118139 - 6118188
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgtttt-ggttttagtccctg |
248 |
Q |
| |
|
|||||||||| ||| ||||||||||||| |||||| |||||||||||||| |
|
|
| T |
6118139 |
atatggttttagtctctgcaaatatgcctcgttttgggttttagtccctg |
6118188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 195 - 240
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | ||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 195 - 244
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| | |||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 20690809 - 20690865
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||| |||||| ||| || |||||||||||||||||| |
|
|
| T |
20690809 |
ggtccctgcaaatatgtctcgttttagttttg-tccctgaccccacttttgtgatgat |
20690865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 195 - 244
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||| ||||| ||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 31037392 - 31037453
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||| |||||||||| |||||||||||||| || |||||| |||||||| |||||| |
|
|
| T |
31037392 |
taagactaaaatatggttttagtccctgcaaatataccttgttttgattttagtctctgtaa |
31037453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 31602225 - 31602281
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||| ||| || |||||||||||||||||| |
|
|
| T |
31602225 |
ggtccctgcaaatatgtctcgttttggttttagtcgctg-ccccacttttgtgatgat |
31602281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 36973430 - 36973487
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||||||| | | |||||||||||||||| |
|
|
| T |
36973430 |
ggtccctgcaaatatgcctcattttgattttggtccctagctccacttttgtgatgat |
36973487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 40038572 - 40038629
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||| || | |||||||||||||||| |
|
|
| T |
40038572 |
ggtccctgcaaatatgcctcattttcattttggtccctggctccacttttgtgatgat |
40038629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 42596450 - 42596511
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||| |||| |||||||| | |||||||||||||| ||||||| |
|
|
| T |
42596450 |
taaggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctgtaa |
42596511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 275 - 323
Target Start/End: Original strand, 19685099 - 19685147
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
19685099 |
tgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
19685147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 247
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||| ||||| |||| ||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 246
Target Start/End: Original strand, 32888760 - 32888800
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccc |
246 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
32888760 |
ttttggtccctgcaaatatgccttgttttggttttggtccc |
32888800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 239
Target Start/End: Complemental strand, 38182089 - 38182041
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttt |
239 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
38182089 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 239
Target Start/End: Original strand, 38189042 - 38189090
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttt |
239 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
38189042 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 239
Target Start/End: Complemental strand, 38209315 - 38209267
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttt |
239 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
38209315 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 239
Target Start/End: Original strand, 38216267 - 38216315
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttt |
239 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
38216267 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 266)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 25615973 - 25616033
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25615973 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25616033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 31480134 - 31480194
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31480134 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
31480194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 184 - 326
Target Start/End: Complemental strand, 7957235 - 7957093
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatat |
283 |
Q |
| |
|
||||||| |||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
7957235 |
tttaaatttggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgtaattttttttgttgtttttggtccctgcaaatat |
7957136 |
T |
|
| Q |
284 |
gcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
| ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
7957135 |
gtctcgttttggttttggtccctgaccccacttttgtgatgat |
7957093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 189 - 251
Target Start/End: Complemental strand, 48924244 - 48924182
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
48924244 |
ataaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaa |
48924182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 49323782 - 49323840
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
49323840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 186 - 248
Target Start/End: Original strand, 54608511 - 54608573
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54608511 |
taaaaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 4513260 - 4513321
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4513260 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4513321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 183 - 248
Target Start/End: Complemental strand, 39437119 - 39437054
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39437119 |
ttttaaacaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
39437054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 1721454 - 1721394
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1721454 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaa |
1721394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 4950035 - 4950095
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4950035 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4950095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 12741273 - 12741213
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
12741273 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
12741213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 19844583 - 19844523
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
19844583 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
19844523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 28552384 - 28552328
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28552384 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 45002387 - 45002327
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45002387 |
aaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaa |
45002327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 184 - 251
Target Start/End: Complemental strand, 47336591 - 47336523
Alignment:
| Q |
184 |
tttaaata-aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
47336591 |
tttaaatataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
47336523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 51550081 - 51550137
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51550081 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 189 - 248
Target Start/End: Original strand, 474040 - 474099
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
474040 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 188 - 251
Target Start/End: Original strand, 4034712 - 4034775
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
4034712 |
aatatggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4034775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 22008890 - 22008835
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 28552020 - 28552079
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
28552020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaa |
28552079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 30106221 - 30106162
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
30106221 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaa |
30106162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 184 - 251
Target Start/End: Complemental strand, 35569145 - 35569078
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||| ||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
35569145 |
tttatataaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35569078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 51550447 - 51550388
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
51550447 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
51550388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 54608864 - 54608805
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
54608864 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
54608805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 9261789 - 9261847
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
9261847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 192 - 246
Target Start/End: Complemental strand, 9262156 - 9262102
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccc |
246 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9262156 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 20612901 - 20612843
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20612901 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
20612843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 189 - 251
Target Start/End: Original strand, 21553885 - 21553947
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||| ||||||| |||||||| |
|
|
| T |
21553885 |
ataaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctgtaa |
21553947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 25710870 - 25710812
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25710812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 26090078 - 26090020
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
26090020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 47336225 - 47336283
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47336225 |
taaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 51834605 - 51834663
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51834605 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51834663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 8940527 - 8940470
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8940527 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 9597098 - 9597037
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9597098 |
taaggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgtaa |
9597037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 11463233 - 11463290
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgtaa |
11463290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 14772208 - 14772269
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
14772208 |
taaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcccggtaa |
14772269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 22008523 - 22008584
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
22008523 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
22008584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 22016041 - 22016102
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
22016041 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
22016102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 28427610 - 28427553
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28427610 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28427553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 32119586 - 32119529
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32119586 |
aaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 37507224 - 37507167
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37507224 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 193 - 246
Target Start/End: Complemental strand, 40370589 - 40370536
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccc |
246 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 43441605 - 43441548
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43441605 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 45320982 - 45320921
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45320982 |
taaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45320921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 326
Target Start/End: Original strand, 47005152 - 47005288
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa-nnnnnnnnnnnnnnnnnggtccatgcaaatatgcctcg |
289 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||| |||||||||||||||| ||||| |||||||||| |||| |
|
|
| T |
47005152 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgtaatttttttttgttgtttttggtccctgcaaatatgtctcg |
47005251 |
T |
|
| Q |
290 |
ttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
47005252 |
ttttggttttcgtccatggccccacttttgtgatgat |
47005288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 3152112 - 3152056
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3152112 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3152056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 3387606 - 3387546
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3387606 |
aaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccatgtaa |
3387546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 5345691 - 5345631
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5345691 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
5345631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 12740906 - 12740962
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
12740906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 20644878 - 20644818
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||| |||||||||| ||||||||||||||| |
|
|
| T |
20644878 |
aaggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgtaa |
20644818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 30268503 - 30268563
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30268503 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30268563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 35565506 - 35565566
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
35565506 |
aaggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgtaa |
35565566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 37506866 - 37506922
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37506866 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37506922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 45002020 - 45002076
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
45002020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 50196301 - 50196357
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
50196357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 247
Target Start/End: Original strand, 3151749 - 3151804
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3151749 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 3830133 - 3830192
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
3830133 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
3830192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 3830517 - 3830458
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3830517 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
3830458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 247
Target Start/End: Original strand, 9603628 - 9603683
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9603628 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct |
9603683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 10976978 - 10977033
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
10977033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 15979338 - 15979393
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 15979702 - 15979643
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
15979702 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
15979643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 21159818 - 21159759
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
21159818 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
21159759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 26089730 - 26089785
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 28942909 - 28942850
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||||| |||||||||||||||||||| |
|
|
| T |
28942909 |
ataaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
28942850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 29490744 - 29490685
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
29490744 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
29490685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 31480500 - 31480445
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 40545563 - 40545622
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
40545563 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaa |
40545622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 47005520 - 47005461
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
47005520 |
aggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgtaa |
47005461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 4035053 - 4034995
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgtaa |
4034995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 9863404 - 9863346
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
9863346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 194 - 248
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22156238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 29445954 - 29446012
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29446012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 251
Target Start/End: Original strand, 29490377 - 29490427
Alignment:
| Q |
201 |
tatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
29490377 |
tatggttttggtccctacaaatatgcaccgttttggttttagtccctgtaa |
29490427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 45313863 - 45313805
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaa |
45313805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 53701663 - 53701605
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
53701605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 4513623 - 4513562
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
4513623 |
taaggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgtaa |
4513562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 8940149 - 8940218
Alignment:
| Q |
182 |
tttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| ||| ||||||||||| || |||||||||| || ||||||||||||||||||||||| |
|
|
| T |
8940149 |
tttttaaaaaaggttaaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgtaa |
8940218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 13584369 - 13584312
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13584369 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
13584312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 193 - 250
Target Start/End: Original strand, 16123139 - 16123196
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
|||||| |||||||||| ||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgta |
16123196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 187 - 244
Target Start/End: Original strand, 20611014 - 20611071
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
20611014 |
aaataaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 25610129 - 25610072
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccttgtaa |
25610072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 26799886 - 26799943
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
26799886 |
aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
26799943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 39132830 - 39132773
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
39132830 |
ggtccctgcaaatatgtctcgttttggttttggtccctggccccacttttgtgatgat |
39132773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 39436716 - 39436773
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
39436716 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39436773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 46751268 - 46751329
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
46751268 |
taaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaa |
46751329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 52342586 - 52342525
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||| ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
52342586 |
taaggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtccatgtaa |
52342525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 474409 - 474353
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
474409 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 183 - 251
Target Start/End: Complemental strand, 2486912 - 2486844
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
2486912 |
ttttatataagactaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccttgtaa |
2486844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 12673642 - 12673702
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| ||||| ||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
12673642 |
aaggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgtaa |
12673702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 184 - 248
Target Start/End: Original strand, 14633536 - 14633600
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||| |||| |||||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
14633536 |
tttaaaaaagactaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctg |
14633600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 193 - 249
Target Start/End: Original strand, 15016388 - 15016444
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
15016444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 28452377 - 28452321
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
28452377 |
aggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 29678022 - 29678082
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||| ||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29678022 |
aaggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgtaa |
29678082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 29955300 - 29955356
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
29955356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 30004454 - 30004510
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
30004510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 39288899 - 39288843
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39288899 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
39288843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 40277820 - 40277880
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
40277820 |
aaggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgtaa |
40277880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 46186773 - 46186713
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
46186773 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgtaa |
46186713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 51500686 - 51500630
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||| | ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 51834943 - 51834887
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51834943 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
51834887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 7588317 - 7588376
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
7588317 |
aggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtctctgtaa |
7588376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 8510214 - 8510269
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg |
8510269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 9603920 - 9603861
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| | ||||||||||| || |||||| |
|
|
| T |
9603920 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttattctctgtaa |
9603861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 185 - 248
Target Start/End: Complemental strand, 10977349 - 10977286
Alignment:
| Q |
185 |
ttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| |||||||| |||||| ||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10977349 |
ttaaaaaaggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg |
10977286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 20644588 - 20644639
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
20644588 |
tgcaaatatgtctcgttttggttttggtccctggccccacttttgtgatgat |
20644639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 27681683 - 27681624
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
27681683 |
aggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgtaa |
27681624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 29955659 - 29955608
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
29955659 |
atatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
29955608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 30004814 - 30004763
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
30004814 |
atatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
30004763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 30034473 - 30034414
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
30034473 |
aggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgtaa |
30034414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 30128283 - 30128342
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||| | ||||||||||||||| ||||||| |
|
|
| T |
30128283 |
aggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgtaa |
30128342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 30130157 - 30130216
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
30130157 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
30130216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 31869957 - 31869898
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
31869957 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaa |
31869898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 43441270 - 43441325
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 50196658 - 50196599
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||||| |||||||||| |||||| |||||||||||||||| |
|
|
| T |
50196658 |
aggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgtaa |
50196599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 3387262 - 3387320
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| ||| ||||||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
3387262 |
taaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 4814534 - 4814588
Alignment:
| Q |
187 |
aaataaggctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
4814534 |
aaataaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 19844265 - 19844323
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| |||||| ||||||||||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgtaa |
19844323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 247
Target Start/End: Complemental strand, 29678387 - 29678333
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct |
29678333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 183 - 245
Target Start/End: Original strand, 34238588 - 34238650
Alignment:
| Q |
183 |
ttttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||| ||| ||||||| |||||||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
34238588 |
tttttaattaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34238650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 34582521 - 34582579
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
34582521 |
taaggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
34582579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 190 - 244
Target Start/End: Original strand, 39288570 - 39288624
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
39288570 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 44802282 - 44802340
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgtaa |
44802340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 3387342 - 3387399
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
3387342 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
3387399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 4034794 - 4034851
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
4034794 |
ggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgat |
4034851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 4322192 - 4322131
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||| |||| ||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
4322192 |
taaggttaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
4322131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 9262077 - 9262020
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
9262077 |
ggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgat |
9262020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 9596759 - 9596816
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgtaa |
9596816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 11463404 - 11463347
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | |||||||| ||||||| |
|
|
| T |
11463404 |
ggtccctgcaaatatgcctcattttggttttggtccatggctccacttttttgatgat |
11463347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 29686541 - 29686602
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
29686541 |
taaggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgtaa |
29686602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 38232238 - 38232299
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| | ||||||| ||||||||| ||||| |
|
|
| T |
38232238 |
taaggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtccttgtaa |
38232299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 45005963 - 45006020
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
45005963 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
45006020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 244
Target Start/End: Original strand, 47114485 - 47114538
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
47114485 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 241
Target Start/End: Original strand, 52342194 - 52342243
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
52342194 |
aggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 52342505 - 52342448
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
52342505 |
ggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgat |
52342448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 52956623 - 52956566
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
52956623 |
ggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgat |
52956566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 275443 - 275499
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| |||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
275443 |
aggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 863654 - 863594
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
863654 |
aaggttaaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgtaa |
863594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 7518088 - 7518148
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
7518088 |
aaggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttgtaa |
7518148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 19656539 - 19656599
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
19656539 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccttgtaa |
19656599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 21159451 - 21159511
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||| ||||||||| ||||| |
|
|
| T |
21159451 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
21159511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 22155928 - 22155984
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
22155928 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22155984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 28427244 - 28427300
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||| || |||||||||||| | |||||||||||||||||||| |
|
|
| T |
28427244 |
aggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg |
28427300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 32119219 - 32119275
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
32119219 |
aggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 243
Target Start/End: Original strand, 35177253 - 35177305
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
35177253 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 40979712 - 40979652
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
40979712 |
aaggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgtaa |
40979652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 45006247 - 45006191
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||| ||||| ||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
45006191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 46622130 - 46622074
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
46622130 |
aggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 49324139 - 49324091
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
49324139 |
atatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 286 - 326
Target Start/End: Original strand, 50009014 - 50009054
Alignment:
| Q |
286 |
ctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50009014 |
ctcgttttggttttggtccatgaccccacttttgtgatgat |
50009054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 51759817 - 51759877
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||| | || |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
51759817 |
aaggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgtaa |
51759877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 1721096 - 1721147
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||| |||||||||| | | ||||||||||||||||||||| |
|
|
| T |
1721096 |
atatggttttggtccttgcaaatatgtctcattttggttttagtccctgtaa |
1721147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 1721170 - 1721221
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| |||||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
1721170 |
tgcaaatatgtctcgttttagttttggtccctggccccacttttgtgatgat |
1721221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 8555225 - 8555174
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| || |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
8555225 |
tgcaaatatgtcttgttttggttttggtccctgaccccacttttgtgatgat |
8555174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 8555301 - 8555250
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
8555301 |
atatggttttggtccatgcaaatatgcatcgttttggttttagtccttgtaa |
8555250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 20405224 - 20405165
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
20405224 |
aggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgtaa |
20405165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 20757407 - 20757454
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||| |||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20757407 |
atatgattttagtccctgcaaatatgcctcgttttggttttagtccct |
20757454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 25609766 - 25609825
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||| | |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
25609766 |
aggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgtaa |
25609825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 25710517 - 25710568
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
25710517 |
atatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
25710568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 28452146 - 28452205
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| | |||||||||||||||| ||||| |
|
|
| T |
28452146 |
aggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgtaa |
28452205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 243
Target Start/End: Original strand, 28942524 - 28942575
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
28942524 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 29446207 - 29446148
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
29446207 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtaa |
29446148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 190 - 245
Target Start/End: Original strand, 29525102 - 29525157
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| | |||||| |||||||||| |
|
|
| T |
29525102 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 245
Target Start/End: Complemental strand, 30130511 - 30130452
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||||||| | |||||||||| ||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
30130511 |
taaataaggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 35407791 - 35407732
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
35407791 |
aggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgtaa |
35407732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 35937042 - 35936991
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
35937042 |
tgcaaatatgtctcgttttagttttggtccatagccccacttttgtgatgat |
35936991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 40169654 - 40169599
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
40169599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 40545832 - 40545781
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
40545832 |
atatgattttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
40545781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 184 - 251
Target Start/End: Original strand, 46186400 - 46186467
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| || ||||| ||||| |||| ||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
46186400 |
tttaaaaaatgctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccttgtaa |
46186467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 48924158 - 48924107
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
48924158 |
tgcaaatatgtctcgtttgggttttggtccctgaccccacttttgtgatgat |
48924107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 194 - 244
Target Start/End: Complemental strand, 3361817 - 3361767
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 250
Target Start/End: Complemental strand, 13514578 - 13514520
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
250 |
Q |
| |
|
||||||| ||||| ||||||| |||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
13514578 |
aggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtccatgta |
13514520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 20644505 - 20644563
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| | | ||||| ||||||||||||||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgtaa |
20644563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 185 - 251
Target Start/End: Complemental strand, 28418908 - 28418842
Alignment:
| Q |
185 |
ttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
28418908 |
ttaaaaaaagctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgtaa |
28418842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 245
Target Start/End: Complemental strand, 34238917 - 34238863
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||||| |||||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
34238917 |
aaggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 39072213 - 39072155
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| || |||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgtaa |
39072155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 40370285 - 40370343
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||| | |||||| |||||||| ||||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgtaa |
40370343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 50009276 - 50009226
Alignment:
| Q |
201 |
tatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
50009276 |
tatggttttggtccttgcaaatatgcctcgttttgattttaatccctgtaa |
50009226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 247
Target Start/End: Complemental strand, 4814901 - 4814845
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||||| |||||||||| |||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
4814901 |
taaggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccct |
4814845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 9597018 - 9596961
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||| ||||| ||||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
9597018 |
ggtccctgcaaatacgcctcattttggttttggtccctgtctccacttttgagatgat |
9596961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 11463480 - 11463423
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| ||||||||| |||| ||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtctctgtaa |
11463423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 14633891 - 14633834
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
14633891 |
aaggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
14633834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 25610054 - 25609997
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| || | |||||||| ||||||| |
|
|
| T |
25610054 |
ggtccctgcaaatatgtctcgttttggttttggtccctgactccacttttctgatgat |
25609997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 203 - 248
Target Start/End: Complemental strand, 25610061 - 25610016
Alignment:
| Q |
203 |
tggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| ||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 30034395 - 30034338
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| || ||||||||||| ||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
30034395 |
ggtccctgtaaatatgcctcattttgattttggtccttgtctccacttttgtgatgat |
30034338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 30552480 - 30552423
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||| ||||| |||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
30552480 |
aaggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 35936777 - 35936838
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||| | ||||||||||||| |||| |||| |
|
|
| T |
35936777 |
taaggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccccgtaa |
35936838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 36673040 - 36673097
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||| | ||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
36673040 |
ggtccctgcaaataagtctcattttggttttggtccctgaccccacttttgtgatgat |
36673097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 40169342 - 40169399
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
40169342 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg |
40169399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 40277899 - 40277956
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| || ||||||| ||||||||| ||||||||| || |||||||||||||||||| |
|
|
| T |
40277899 |
ggtccctgaaaatatgtctcgttttgattttggtccctgaccccacttttgtgatgat |
40277956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 40370511 - 40370454
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| | || ||| |||||||||||| |
|
|
| T |
40370511 |
ggtccctgcaaatatgcctcattttggttttggtccctttctccatttttgtgatgat |
40370454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 191 - 240
Target Start/End: Original strand, 53113441 - 53113490
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggtttt |
240 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | ||||||| |||| |
|
|
| T |
53113441 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 53113460 - 53113517
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
53113460 |
ggtccctgcaaatatgtctcgttttgtttttggtcactgaccccacttttgtgatgat |
53113517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 8510522 - 8510474
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8510522 |
atatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
8510474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 244
Target Start/End: Original strand, 15286155 - 15286207
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 278 - 326
Target Start/End: Complemental strand, 29678301 - 29678253
Alignment:
| Q |
278 |
aaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
29678301 |
aaatatgcctcgttttggttttggtctctagccccacttttgtgatgat |
29678253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 30034109 - 30034165
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||||||||||||||| || ||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgtaa |
30034165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 31869596 - 31869652
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| | |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgtaa |
31869652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 247
Target Start/End: Original strand, 43440493 - 43440549
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||| | |||||| |||||||||||| |
|
|
| T |
43440493 |
aaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 45005893 - 45005941
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||||| |||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
45005893 |
atatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 49670803 - 49670747
Alignment:
| Q |
193 |
ggctaagatatggttttggtccc-tgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg |
49670747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 194 - 242
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttag |
242 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Complemental strand, 2486819 - 2486768
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||| || |||| |||||||||||| |||||||||||||||||| |
|
|
| T |
2486819 |
tgcaaatatgcttcattttagttttggtccatagccccacttttgtgatgat |
2486768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 9863054 - 9863100
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||| |||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
9863054 |
atatggttttagtccctgcaa-tatgcctcgttttggttttagtccct |
9863100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 36672970 - 36673021
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||||||||||||| |||||| |
|
|
| T |
36672970 |
atatggttttggtctctgcaaatatgtcttgttttggttttagtctctgtaa |
36673021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 38232593 - 38232542
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||| |||||||||||| | ||||||||||| |||| |||||| |
|
|
| T |
38232593 |
atatggttttggtacctgcaaatatgtctcgttttggtttcagtctctgtaa |
38232542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 39132907 - 39132848
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | | ||||||| ||||||||||| |
|
|
| T |
39132907 |
aggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctgtaa |
39132848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 245
Target Start/End: Complemental strand, 43440774 - 43440735
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43440774 |
ttttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 200 - 251
Target Start/End: Original strand, 45161120 - 45161171
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
45161120 |
atatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgtaa |
45161171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 54767520 - 54767469
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||| ||||||| | ||||||| ||||||||||||||| |
|
|
| T |
54767520 |
atatggttttggtccctagaaatatgtctcgttttgattttagtccctgtaa |
54767469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 474331 - 474277
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
474331 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
474277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 3387338 - 3387380
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
3387338 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3387380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 4034790 - 4034832
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
4034790 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4034832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 9262081 - 9262039
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
9262081 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9262039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 11312571 - 11312513
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||| ||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
11312571 |
taaggctaaaatatggcattggtccatgcaaatatgttcagttttggttttagtccctg |
11312513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 12740984 - 12741038
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
12740984 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
12741038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 15979415 - 15979469
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
15979415 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
15979469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 22008813 - 22008759
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
22008813 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
22008759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 22016331 - 22016277
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
22016331 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
22016277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 26089807 - 26089861
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
26089807 |
ggtccctgcaaatatgtctctttttggttttggtccctggctccacttttgtgat |
26089861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 28552306 - 28552252
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
28552306 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
28552252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 30424628 - 30424686
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| | ||||| ||||||||| |||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtctctgtaa |
30424686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 31480423 - 31480369
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
31480423 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
31480369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 32119507 - 32119453
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
32119507 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
32119453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 189 - 251
Target Start/End: Original strand, 35533275 - 35533337
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| |||| |||||||||||||| ||||||||||| | ||||||||||||| || ||||| |
|
|
| T |
35533275 |
ataagactaaaatatggttttggtctctgcaaatatgtcttgttttggttttagaccttgtaa |
35533337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 244
Target Start/End: Original strand, 35565581 - 35565619
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagtc |
35565619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 39132834 - 39132792
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||| |
|
|
| T |
39132834 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
39132792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 275 - 325
Target Start/End: Complemental strand, 40545756 - 40545706
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatga |
325 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||| ||| ||||||| |
|
|
| T |
40545756 |
tgcaaatatgcctcgttttggttttggtctctgaccccattttagtgatga |
40545706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 45005959 - 45006001
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
45005959 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
45006001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 52342509 - 52342467
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
52342509 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52342467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 52401014 - 52401072
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
52401014 |
taaggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccctg |
52401072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 52956627 - 52956585
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
52956627 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52956585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 53121299 - 53121357
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
53121299 |
taaggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
53121357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 54608595 - 54608649
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
54608595 |
ggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgat |
54608649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 318
Target Start/End: Complemental strand, 863575 - 863526
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccactttt |
318 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || |||||||||| |
|
|
| T |
863575 |
ggtccctgcaaatatgtctcattttggttttggtccctgaccccactttt |
863526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 275 - 308
Target Start/End: Complemental strand, 3387581 - 3387548
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgt |
308 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
3387581 |
tgcaaatatgcctcgttttggttttagtccatgt |
3387548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 9603706 - 9603763
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| || ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
9603706 |
ggtccctgcaaatatgtcttattttggttttggtccctgactccacttttgtgatgat |
9603763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 14772289 - 14772346
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| | || | |||||||||||||||||| |
|
|
| T |
14772289 |
ggtccatgcaaatatgtctcgttttagttttagccccttaccccacttttgtgatgat |
14772346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 19844343 - 19844400
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||||| || | ||||||||||||||| |
|
|
| T |
19844343 |
ggtccctgtaaatatgcctcattttggttttggtccctggctgcacttttgtgatgat |
19844400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Complemental strand, 20405146 - 20405089
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| || | |||||||||||||||| |
|
|
| T |
20405146 |
ggtccttgcaaatatgcctaattttggttttggtctctgactccacttttgtgatgat |
20405089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 249
Target Start/End: Complemental strand, 20907450 - 20907401
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||||||| |||||||||||||||| | |||||||||||||| |||| |
|
|
| T |
20907450 |
atatggttttaatccctgcaaatatgcctcattttggttttagtctctgt |
20907401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 27681394 - 27681451
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||| | ||||||||| ||||||||| || ||||||||||||||||| |
|
|
| T |
27681394 |
ggtccctgcaaatacgtctcgttttgattttggtccctgatcccacttttgtgatgat |
27681451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 28418626 - 28418675
Alignment:
| Q |
277 |
caaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||| ||| ||||||||||||| | || |||||||||||||||||| |
|
|
| T |
28418626 |
caaatatgtctcattttggttttggttcctggccccacttttgtgatgat |
28418675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 193 - 246
Target Start/End: Complemental strand, 30426226 - 30426174
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccc |
246 |
Q |
| |
|
|||||| |||||||||| |||| |||||||||||| ||||||| |||||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 35177332 - 35177389
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
35177332 |
ggtccttgtaaatatgtctcgttttggttttggtctctggctccacttttgtgatgat |
35177389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 35565585 - 35565642
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||||||| |||||||||| ||| || | |||||||||||||||| |
|
|
| T |
35565585 |
ggtccctgcaaatatgcctcattttggttttagtctctggctccacttttgtgatgat |
35565642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 194 - 243
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt |
36673195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 273 - 326
Target Start/End: Complemental strand, 38232527 - 38232474
Alignment:
| Q |
273 |
catgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||||| || |||||||||||| ||| || || ||||||||||||||| |
|
|
| T |
38232527 |
catgcaaatatgtcttgttttggttttgatccctgacctcacttttgtgatgat |
38232474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 40370515 - 40370474
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| |||||| |
|
|
| T |
40370515 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
40370474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 275 - 308
Target Start/End: Complemental strand, 52342560 - 52342527
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgt |
308 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
52342560 |
tgcaaatatgcctcgttttggttttagtccatgt |
52342527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 202 - 243
Target Start/End: Complemental strand, 52956691 - 52956650
Alignment:
| Q |
202 |
atggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
52956691 |
atggttttggtctctgcaaatatgcatcgttttggttttagt |
52956650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 54767248 - 54767305
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||||||||| ||||| || || |||||||||||||||||| |
|
|
| T |
54767248 |
ggtccctgcaaatatgtctcgttttgtttttgatctctgaccccacttttgtgatgat |
54767305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 243
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| | | ||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 243
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||| |||||||||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 10778368 - 10778428
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| ||| |||||||||| || ||||||||||||| ||||||| ||||||| ||||||| |
|
|
| T |
10778368 |
aaggttaaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctgtaa |
10778428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 14772523 - 14772467
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| || | ||||||||| || | ||||||||||||||||||||| |
|
|
| T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctgtaa |
14772467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 235
Target Start/End: Original strand, 25353197 - 25353241
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttg |
235 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
25353197 |
aaggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 251
Target Start/End: Complemental strand, 33794788 - 33794748
Alignment:
| Q |
211 |
gtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
33794788 |
gtccctgcaaatatgcctcgttttaattttagtccctgtaa |
33794748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 224
Target Start/End: Complemental strand, 39820664 - 39820632
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatat |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
39820664 |
aggctaaaatatggttttggtccctgcaaatat |
39820632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 211 - 251
Target Start/End: Original strand, 40560492 - 40560532
Alignment:
| Q |
211 |
gtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
40560492 |
gtccctgcaaatatgcctcgttttaattttagtccctgtaa |
40560532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 270 - 306
Target Start/End: Complemental strand, 43440769 - 43440733
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccat |
306 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
43440769 |
gtccctgcaaatatgcctcgttttggttttagtccat |
43440733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 270 - 326
Target Start/End: Complemental strand, 47114736 - 47114680
Alignment:
| Q |
270 |
gtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| || || || ||||||||||||||| |
|
|
| T |
47114736 |
gtccctgcaaatatgtctcgttttggttttgatctctgacctcacttttgtgatgat |
47114680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #263
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 224
Target Start/End: Complemental strand, 47433869 - 47433837
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatat |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
47433869 |
aggctaaaatatggttttggtccctgcaaatat |
47433837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #264
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 249
Target Start/End: Complemental strand, 47902145 - 47902089
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
|||||| |||| ||||| ||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
47902145 |
ggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctgt |
47902089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #265
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 244
Target Start/End: Original strand, 51500397 - 51500449
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| |||||||| | ||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
51500397 |
aggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #266
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 52403184 - 52403128
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
52403184 |
aggctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtccctg |
52403128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 52; Significance: 9e-21; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 82707 - 82648
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
82707 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
82648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 82338 - 82396
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
82338 |
taaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 82418 - 82475
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
82418 |
ggtccctgcaaatatgccttattttggttttggtccctggctccacttttgtgatgat |
82475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 189 - 251
Target Start/End: Original strand, 2774 - 2836
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2774 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 366276 - 366215
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
366276 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
366215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 365979 - 366037
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgtaa |
366037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 49; Significance: 6e-19; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Complemental strand, 75765 - 75709
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
75765 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 75358 - 75417
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
75358 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaa |
75417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 27365 - 27306
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
27365 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
27306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 27072 - 27114
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
27114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 27076 - 27129
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtga |
322 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| || | | |||||||||| |
|
|
| T |
27076 |
ggtccctgcaaatatgcctcgttttggttttggtccctgacacaacttttgtga |
27129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 9028 - 8970
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
8970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 8734 - 8790
Alignment:
| Q |
195 |
ctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
8790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 148282 - 148224
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
148224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 276 - 326
Target Start/End: Original strand, 147971 - 148021
Alignment:
| Q |
276 |
gcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||||||||| ||||||||||||||| || | ||||||||||||||| |
|
|
| T |
147971 |
gcaaatatgcctcattttggttttggtccctggcttcacttttgtgatgat |
148021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 14696 - 14753
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14696 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 15013 - 14954
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaa |
14954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 46; Significance: 3e-17; HSPs: 6)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 47923 - 47980
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
47923 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 251
Target Start/End: Complemental strand, 48224 - 48173
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
48224 |
atatggttttggtccctgcaaatatgcctcattttggttttagtctctgtaa |
48173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 269 - 328
Target Start/End: Original strand, 222888 - 222947
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgatgt |
328 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
222888 |
ggtccctgcaaatatgtctcgttttggttttggtccctagccccacttttgtgatgatgt |
222947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 47942 - 47999
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
47942 |
ggtccctgcaaatatgtctcgttttggttttagtccctgaccccacttttgtgatgat |
47999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 192 - 245
Target Start/End: Complemental strand, 223173 - 223120
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
223173 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 222884 - 222925
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
222884 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
222925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 5207 - 5267
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
5207 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
5267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 5227 - 5287
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
5227 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
5287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 3920 - 3860
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3920 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
3860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 184 - 251
Target Start/End: Original strand, 3523 - 3590
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| || |||||| |||||||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
3523 |
tttaattatggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
3590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 45; Significance: 1e-16; HSPs: 5)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 54813 - 54873
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54813 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
54873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 50071 - 50023
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
50071 |
atatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 55172 - 55124
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
55172 |
atatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 50001 - 49947
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
50001 |
ggtccttgcaaatatgtctcattttggttttggtccctgactccacttttgtgat |
49947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 323
Target Start/End: Complemental strand, 55102 - 55048
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgat |
323 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
55102 |
ggtccttgcaaatatgtctcattttggttttggtccctgactccacttttgtgat |
55048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 192 - 247
Target Start/End: Complemental strand, 2661 - 2606
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2661 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 241
Target Start/End: Original strand, 2341 - 2382
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
2341 |
atatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 293 - 234
Alignment:
| Q |
189 |
ataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
293 |
ataaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 190 - 248
Target Start/End: Original strand, 8544 - 8602
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8544 |
taaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
8602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 12182 - 12240
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
12240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 12536 - 12478
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
12478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 1309 - 1366
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
1309 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
1366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 1646 - 1589
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||| ||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1646 |
aaggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg |
1589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 3)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 22058 - 21997
Alignment:
| Q |
190 |
taaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||| |||| ||||||||||||||||| ||||| |
|
|
| T |
22058 |
taaggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttgtaa |
21997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 326
Target Start/End: Original strand, 21767 - 21824
Alignment:
| Q |
269 |
ggtccatgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
21767 |
ggtccctgcaaatatgtctcgttttggttttggtccctagccccacttttgtgatgat |
21824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 21763 - 21804
Alignment:
| Q |
206 |
ttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
21763 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
21804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 184 - 248
Target Start/End: Complemental strand, 5717 - 5653
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
||||| ||||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
5717 |
tttaattaaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
5653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 244
Target Start/End: Original strand, 5397 - 5450
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
5397 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 184 - 251
Target Start/End: Original strand, 12516 - 12583
Alignment:
| Q |
184 |
tttaaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||| || |||||| |||||||||| ||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
12516 |
tttaattatggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
12583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 3292 - 3233
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
3292 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
3233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 248
Target Start/End: Original strand, 34931 - 34986
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||| ||||||| || ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
34986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 18044 - 17985
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
18044 |
aggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgtaa |
17985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 326
Target Start/End: Original strand, 3751 - 3885
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaannnnnnnnnnnnnnnnnggtccatgcaaatatgcctcgtt |
291 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||| ||| || |
|
|
| T |
3751 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgtaaaaaaatttgtcgtttttggtccatgcaaatatgtctcatt |
3850 |
T |
|
| Q |
292 |
ttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||| ||||||||| || | |||||||||||||||| |
|
|
| T |
3851 |
ttgattttggtccctggctccacttttgtgatgat |
3885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 244
Target Start/End: Complemental strand, 4080 - 4028
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtc |
244 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| | |||||| ||||||||| |
|
|
| T |
4080 |
aggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 192 - 251
Target Start/End: Original strand, 94056 - 94115
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| |||||| |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
94056 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaa |
94115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 194 - 241
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
194 |
gctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
||||| |||||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 4312 - 4254
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgtaa |
4254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 4016 - 4064
Alignment:
| Q |
200 |
atatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||||| |||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Original strand, 16724 - 16782
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgtaa |
16782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 16806 - 16857
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| || | |||||||||||||||| |
|
|
| T |
16806 |
tgcaaatatgtctcattttggttttggtccctgactccacttttgtgatgat |
16857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 193 - 251
Target Start/End: Complemental strand, 17966 - 17908
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaa |
17908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 245
Target Start/End: Original strand, 4040 - 4093
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
4040 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
4093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 245
Target Start/End: Original strand, 19222 - 19275
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
19222 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 245
Target Start/End: Complemental strand, 4290 - 4236
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
4290 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
4236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 245
Target Start/End: Complemental strand, 19472 - 19418
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
19472 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
19418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 192 - 249
Target Start/End: Original strand, 24371 - 24428
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgt |
249 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
24371 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 61630 - 61687
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
248 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
61630 |
aaggctaaaatatggtattggtccctgcaaatatgcacagttttgattttagtccctg |
61687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 189411 - 189462
Alignment:
| Q |
275 |
tgcaaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
189411 |
tgcaaatatgactcattttggttttggtccctggccccacttttgtgatgat |
189462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 251
Target Start/End: Complemental strand, 189685 - 189620
Alignment:
| Q |
186 |
taaataaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||| |||||||| |||| ||||| ||| ||||||||||||| | ||||||||||| || |||||| |
|
|
| T |
189685 |
taaaaaaggctaaaatatagtttttgtcgctgcaaatatgcctcattttggttttaatctctgtaa |
189620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 8328 - 8388
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||| ||||||||| ||||| |
|
|
| T |
8328 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
8388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 8644 - 8584
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| | ||||||| ||||||||| ||||| |
|
|
| T |
8644 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
8584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 193 - 245
Target Start/End: Original strand, 10168 - 10220
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtcc |
245 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 10516 - 10457
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
10516 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgtaa |
10457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 251
Target Start/End: Complemental strand, 35085 - 35026
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
251 |
Q |
| |
|
||||||| ||||||||||| ||| | |||||||| | ||||||||||||||||||||||| |
|
|
| T |
35085 |
aggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgtaa |
35026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 278 - 326
Target Start/End: Complemental strand, 34999 - 34951
Alignment:
| Q |
278 |
aaatatgcctcgttttggttttggtccatgtccccacttttgtgatgat |
326 |
Q |
| |
|
||||||| ||||||||||||||||||| || ||||||||| ||||||| |
|
|
| T |
34999 |
aaatatgtctcgttttggttttggtccctggtcccacttttatgatgat |
34951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 247
Target Start/End: Original strand, 2500 - 2555
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
2500 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 247
Target Start/End: Complemental strand, 2883 - 2829
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggttttagtccct |
247 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||| |||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 5072 - 5020
Alignment:
| Q |
191 |
aaggctaagatatggttttggtccctgcaaatatgccccgttttggttttagt |
243 |
Q |
| |
|
|||| ||| |||||||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
5072 |
aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 224
Target Start/End: Complemental strand, 11586 - 11550
Alignment:
| Q |
188 |
aataaggctaagatatggttttggtccctgcaaatat |
224 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
11586 |
aataaggctaaaatatgtttttggtccctgcaaatat |
11550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 224
Target Start/End: Complemental strand, 30967 - 30935
Alignment:
| Q |
192 |
aggctaagatatggttttggtccctgcaaatat |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
30967 |
aggctaaaatatggttttggtccctgcaaatat |
30935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
193 |
ggctaagatatggttttggtccctgcaaatatgccccgttttggtttta |
241 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||| | ||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University