View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20551_low_1 (Length: 313)
Name: NF20551_low_1
Description: NF20551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20551_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 147 - 242
Target Start/End: Original strand, 11738911 - 11739006
Alignment:
| Q |
147 |
attgatgtaaaatatttattcatgactacaataaacttgaacttcaacgtttgcaaagagtaaaaacgtacaaataaatctaaactgaatttatga |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11738911 |
attgatgtaaaatatttattcatgactacaataaacttgaacttcaacgtttgaaaagagtaaaaacgtacaaataaatctaaactgagtttatga |
11739006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 21 - 133
Target Start/End: Original strand, 11738728 - 11738841
Alignment:
| Q |
21 |
cgctactataattacatttgtaaccgtatgaaccatagtttaattttatggaatc-aagaattgatgtttgtcgcacttgaattagcacttgcaaaattt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
11738728 |
cgctactataattacatttgtaaccgtatgaaccatagttgaattttatggaatcaaatcattgatgtttgttgcacttgaattagcacttgcaaaactt |
11738827 |
T |
 |
| Q |
120 |
tcattgatcttaac |
133 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
11738828 |
tcattgatcttaac |
11738841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University