View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20552_low_14 (Length: 242)
Name: NF20552_low_14
Description: NF20552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20552_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 31573459 - 31573686
Alignment:
| Q |
1 |
acaaagaaacagtatggtagcactcacttagaaccactaaagacaaagagaggaatattttagatcaaactaacacttgggacaagtttcatgtcaaaac |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31573459 |
acaaagaaacagtatgttagcactcacttagaaccacaaaagacaaagagaggaatattttagatcaaactaacacttgggacaagtttcatgtcaaaac |
31573558 |
T |
 |
| Q |
101 |
tgtatagtaacataaaacttagagaagagaatgggaaactgagagtaattaaggccagaaagtgctacaataaaacaagttggtttagtagtgtataaat |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31573559 |
tgtctagtaacataaaacttagagaagagaatgggaaactgagagtagttaaggccagaaagtgctacaataaaacaagttggtttagtagtgtataaat |
31573658 |
T |
 |
| Q |
201 |
agaagaaggattggcagaatgtgaaaaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31573659 |
agaagaaggattggcagaatgtgaaaaa |
31573686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University