View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20552_low_6 (Length: 419)
Name: NF20552_low_6
Description: NF20552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20552_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 408
Target Start/End: Original strand, 44040964 - 44041361
Alignment:
| Q |
1 |
atcaacaggacaacaagaccacccctttctttctcacttcttaccaaattcttcttcctcggccttgtcgggtatgtgtgtaattgcattacattagtcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44040964 |
atcaacaggacaacaagaccacccctttctttctcacttcttgccaaatttttcttcctcggccttgtcgggtatgtgtgtaattgcattacattagtcg |
44041063 |
T |
 |
| Q |
101 |
tattatttaaggtttcaaatcgtgatcgcatgatttgactgatactcaaacataaaaggctttgtaatagcgtggcggccacaactgtggtggctgatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
44041064 |
tattatttaaggtttcaaatcgtgatcgcatgatttgactgatactcaaacataaaaggctttgtaacagcttagcggccacaactgtggtggctgatta |
44041163 |
T |
 |
| Q |
201 |
tttaaggtttcaaatggcgattgcatgaattcgactgatactggaactaaaagagtttataattgcagccacaactgtggtggctgattgtttttaaaat |
300 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44041164 |
tttaaggttttaaatggcgattgcatggattcgactgatactggaactaaaaga---tttaattgcggccacaactgtggtggctgattgtttttaaaat |
44041260 |
T |
 |
| Q |
301 |
cttgattgtgtctattttctatccctttatgagataattactaaatagaaatgaggaatcatgattcatgatcattggaaatttgcagcataactatcat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44041261 |
cttgattgtgtctattttctatccctttatgagataattactaaatagaaatgaagaa-------tcatgatcattggaaatttgcagcataactatcat |
44041353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University