View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_high_35 (Length: 299)
Name: NF20553_high_35
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 151 - 275
Target Start/End: Original strand, 48908578 - 48908702
Alignment:
| Q |
151 |
gagggaagagagagtgagcaccgtgatgagaataggagaaaacagctctgtaggtgtagacatgatcgccgggtttgatttcgtgtttctcaattctgtt |
250 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48908578 |
gaggaaagagagagtgagaaccgtgatgagaataggagaaaacagctctgtaggtgtagacatgatcgccgggtttgatgtcgtgtttctcaattctgtt |
48908677 |
T |
 |
| Q |
251 |
agaaatcaaacccattcacattcac |
275 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48908678 |
agaaatcaaacccattcacattcac |
48908702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 14 - 122
Target Start/End: Original strand, 48908447 - 48908551
Alignment:
| Q |
14 |
aaagtaagcagaaaataataattataattggtcatttgtgagattattaatttatttatgataagttgggatctgatattctgcattggagggagcaggc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48908447 |
aaagtaagcagaaaataataattataattggtcatttgtgagattatt----tatttatgataagttcggatctgatattctgcattggagggagcaggc |
48908542 |
T |
 |
| Q |
114 |
aagaaaaac |
122 |
Q |
| |
|
||||||||| |
|
|
| T |
48908543 |
aagaaaaac |
48908551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University