View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_high_44 (Length: 254)
Name: NF20553_high_44
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_high_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 3 - 185
Target Start/End: Original strand, 31729059 - 31729241
Alignment:
| Q |
3 |
atgcataaattaactcttcaagagctgtatagtctggcatgtgatatcggtctgaaactcattggtaaggggaggggtttcagtaataccacctgcacaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31729059 |
atgcataaattaactcttcaagagctgtatagtctggcatgtgatatcggtctgaaactcattggtaaggggaggggtttcagtaataccacctgcacaa |
31729158 |
T |
 |
| Q |
103 |
aaggacatgattacagtttatgcattgatataccagagatactataatccggatcagaatcgcacaactaccaatcttgactc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31729159 |
aaggacatgattacagtttatgcattgatataccagagatactataatccggatcagaatcgcacaactaccaatcttgactc |
31729241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 51636574 - 51636762
Alignment:
| Q |
1 |
aaatgcataaattaactcttcaagagctgtata---gtctggcatgtgatatcggtctgaaactcattggtaagggga-ggggtttcagtaataccacct |
96 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
51636574 |
aaatgtataaattaactcttcaagagctgtataacagtctggcatgtgatatcggtctgaaatgcattggtaagggcaaggggtttcagtaataccacct |
51636673 |
T |
 |
| Q |
97 |
gcacaaaaggacatgattacagtttatgcattgatataccagagatactataatccggatcagaatcgcacaactaccaatcttgactc |
185 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||| ||||| |||| |
|
|
| T |
51636674 |
gcacaaaaggacatgattgcaatttatgcattgatataccagagatgctataatccgggtcagaattgcacaactacccatcttcactc |
51636762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 200 - 254
Target Start/End: Complemental strand, 29195305 - 29195251
Alignment:
| Q |
200 |
caattaaaatttattcaagcaaacatggtcgagagggagtgtttcatgaaagtga |
254 |
Q |
| |
|
||||||| |||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29195305 |
caattaagatttattcaatcaaacatggtcgggagggagtgtttcatgaaagtga |
29195251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University