View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20553_high_48 (Length: 241)

Name: NF20553_high_48
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20553_high_48
NF20553_high_48
[»] chr2 (2 HSPs)
chr2 (1-76)||(16240397-16240472)
chr2 (150-225)||(16240546-16240621)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 16240397 - 16240472
Alignment:
1 aactattgtatttgttactatgatcacccttgaattgctcccaatccttataaattgaaataatacgtacaataaa 76  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16240397 aactattgtatttgttactatgatcacccttgaattgctcccaatccttataaattgaaataatacgtacaataaa 16240472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 16240546 - 16240621
Alignment:
150 tcattcacgttgaaattcagtattagatctaaatgtaaactataaacaggaataagattataggagcacaatcttt 225  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
16240546 tcattcacgttgaaattcagtattagatctaattgtaaactataaacaggaataagattataggagcacaatcttt 16240621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University