View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_high_54 (Length: 234)
Name: NF20553_high_54
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_high_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 92 - 218
Target Start/End: Complemental strand, 831954 - 831828
Alignment:
| Q |
92 |
tcaccttgcttataatttacaccgaaggaaaccgccttataagtttcggttgaagtatcataaccaaaagagaattgattgtaactcaaccacggatggg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
831954 |
tcaccttgcttataatttacaccgaaggataccgccttataagtttcggttgaagtatcataaccaaaagagaactgattgtaactcaaccacggatggg |
831855 |
T |
|
| Q |
192 |
ataaacgatattcagatgttgtggctg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
831854 |
ataaacgatattcagatgttgtggctg |
831828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University