View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_high_6 (Length: 519)
Name: NF20553_high_6
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 3e-46; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 18 - 112
Target Start/End: Original strand, 27652004 - 27652098
Alignment:
| Q |
18 |
ttataaacatcagtagaataagaagaagcacattgacttgcttctcaaccctatctctgaccagtgaccacttctttgatcagctcctctcgatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27652004 |
ttataaacatcagtagaataagaagaagcacattgacttgcttctcaaccctatctctgaccagtgaccacttctttgatcagctcctctcgatt |
27652098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 428 - 509
Target Start/End: Original strand, 27652254 - 27652337
Alignment:
| Q |
428 |
taacgaaagaaacatccaaccagtagcgagnnnnnnn--aatgtaaaaacagctaacccttcccaattttctattagacctatg |
509 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27652254 |
taacgaaagaaacatccaaccagtagcgagtttttttttaatgtaaaaacagctaaccattcccaattttctattagacctatg |
27652337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 33 - 80
Target Start/End: Original strand, 11683105 - 11683152
Alignment:
| Q |
33 |
gaataagaagaagcacattgacttgcttctcaaccctatctctgacca |
80 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11683105 |
gaataagaggaagcacattgacttgattctcaaccctatctctgacca |
11683152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 33 - 80
Target Start/End: Complemental strand, 11718053 - 11718006
Alignment:
| Q |
33 |
gaataagaagaagcacattgacttgcttctcaaccctatctctgacca |
80 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11718053 |
gaataagaggaagcacattgacttgattctcaaccctatctctgacca |
11718006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 109 - 162
Target Start/End: Original strand, 11684292 - 11684345
Alignment:
| Q |
109 |
gattatgcctctatctaattagttgtaacgtttaacaacaactcgttattatat |
162 |
Q |
| |
|
|||||||||||||||||||| ||| || ||||||||||||||||||||||||| |
|
|
| T |
11684292 |
gattatgcctctatctaattggttacaatgtttaacaacaactcgttattatat |
11684345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 109 - 162
Target Start/End: Complemental strand, 11716866 - 11716813
Alignment:
| Q |
109 |
gattatgcctctatctaattagttgtaacgtttaacaacaactcgttattatat |
162 |
Q |
| |
|
|||||||||||||||||||| ||| || ||||||||||||||||||||||||| |
|
|
| T |
11716866 |
gattatgcctctatctaattggttacaatgtttaacaacaactcgttattatat |
11716813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University