View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20553_high_60 (Length: 218)

Name: NF20553_high_60
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20553_high_60
NF20553_high_60
[»] chr8 (1 HSPs)
chr8 (1-199)||(37969581-37969779)


Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 37969779 - 37969581
Alignment:
1 tatacatccaaataaatcatcaatattgtttgaaactgttaacccatgattgtgacaagattttcgaatccttcccaagattgttaaccttaaatttaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37969779 tatacatccaaataaatcatcaatattgtttgaaactgttaacccatgattgtgacaagattttcgaatccttcccaagattgttaaccttaaatttaca 37969680  T
101 aacaacatgagatgtcataacccatgttttgagtcccgaagccgtcatcctgacaccaagattcatatccaattcaaagttcacgggcttctttgccat 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||    
37969679 aacaacatgagatgtcataacccatgttttgagtcccgaagccgtcatcctcacaccaagattcatatccaattcaaagttcacgggcatctttgccat 37969581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University