View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20553_high_62 (Length: 216)
Name: NF20553_high_62
Description: NF20553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20553_high_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 25 - 200
Target Start/End: Original strand, 47562628 - 47562803
Alignment:
| Q |
25 |
taaattataattaatagcattagttttccctatgattcaccccatctcaacaatgggtttggcatgcatcttctaacgaatggactctcttaaaaataca |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47562628 |
taaattataattaatagcattagttttccctatgattcaccccatcttagcattgggtttggcatgcatcttctaacgaattgactctcttaaaaataca |
47562727 |
T |
|
| Q |
125 |
catgtgtatgtcaacatcctaaatctatctggaaatatatgtagaccatcataatctcaaattgcatagtaagaaa |
200 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47562728 |
catgcgtatgtcaacatcctaaatgtatctggaaatatatgtagaccatcataatcccaaattgcatagtaagaaa |
47562803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University